Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12881

Dsg2 desmoglein 2 ( MGI:1196466)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881
"Pseudo-wholemount" of euxassay_013590. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013590_01 euxassay_013590_02 euxassay_013590_03 euxassay_013590_04
EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881
euxassay_013590_05 euxassay_013590_06 euxassay_013590_07 euxassay_013590_08 euxassay_013590_09
EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881
euxassay_013590_10 euxassay_013590_11 euxassay_013590_12 euxassay_013590_13 euxassay_013590_14
EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881
euxassay_013590_15 euxassay_013590_16 euxassay_013590_17 euxassay_013590_18 euxassay_013590_19
EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881 EMAGE:12881
euxassay_013590_20 euxassay_013590_21 euxassay_013590_22 euxassay_013590_23 euxassay_013590_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12881Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12881_wholemount_strong.wlz
12881_wholemount_moderate.wlz
12881_wholemount_weak.wlz
12881_wholemount_possible.wlz
12881_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12881_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 11 21 22 23 weak expression: see section 12 13 20
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22
thyroid gland
moderate moderate
regionalmoderate expression: see section 13 14 15 17 18 19
epidermis
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 11
vibrissa
moderate moderate
regionalmoderate expression: see section 05
vibrissa epidermal component
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 12 22 23 24 weak expression: see section 11
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 20 21 22 23 24
cornea epithelium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06
anterior naris epithelium
weak weak
regionalweak expression: see section 14 15 16 17 18 19
external naris epithelium
weak weak
regionalweak expression: see section 14 15 17 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 22
naso-lacrimal duct
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 06 08 09 10 11 12 13 21 22 23 24
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 15
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18
tongue epithelium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
rectum
moderate moderate
regionalmoderate expression: see section 16
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
strong strong
regionalstrong expression: see section 13 moderate expression: see section 14 15 18 19 20
lower jaw molar
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 21 22 23
oral epithelium
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 07 08 11 12 13 14 15 16 17 18 19 20 21 22 23 24
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 15 18 19 20
upper jaw molar
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 21 22
bladder
moderate moderate
regionalmoderate expression: see section 15 16 17
kidney calyx
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 11 12 13 21 22 23 24
kidney pelvis
weak weak
regionalweak expression: see section 11
urethra of male
moderate moderate
regionalmoderate expression: see section 15 16
larynx
moderate moderate
regionalmoderate expression: see section 15 16
left lung
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 11 13 14 15 16 weak expression: see section 08 12
right lung
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 22 23 24
trachea epithelium
moderate moderate
regionalmoderate expression: see section 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31713
Entity Detected:Dsg2, desmoglein 2 ( MGI:1196466)
Sequence:sense strand is shown

>T31713
TCGTCAAAAGAGGGCCTGGATCACTGCCCCTGTGGCTCTGCGGGAGGGCGAAGACCTGTCCAGAAAGAAC
CCGATTGCCAAGATACACTCTGACCTTGCAGAAGAAAAAGGGATAAAAATCACGTACAAGTACACTGGGA
AGGGAATTACAGAACCGCCTTTCGGCATATTCGTCTTTGATAGAAACACAGGAGAACTGAACATCACTAG
CATTCTTGACCGGGAAGAAACACCATATTTTCTGCTGACAGGCTATGCATTGGACTCCAGAGGAAACAAC
CTGGAAAAGCCCTTGGAACTACGCATCAAAGTTCTGGACATCAATGACAACGAGCCAGTGTTCACACAGG
AGGTCTTTGTTGGGTCCATTGAGGAATTGAGTGCAGCACATACACTTGTGATGAAAATCACCGCCACAGA
TGCAGATGACCCGGAGACTCTGAATGCTAAAGTCTCCTACAGAATTGTCTCTCAGGAGCCTGCAAATAGT
CATATGTTCTACCTAAATAAAGACACGGGGGAGATCTATACGACCAGTTTTACTTTGGACAGAGAGGAAC
ACAGCAGCTATTCCTTGACGGTGGAAGCAAGAGATGGTAACGGGCAGATAACAGACAAGCCAGTCCAGCA
AGCTCAAGTTCAGATCCGTATATTGGATGTCAATGACAATATACCTGTGGTAGAAAACAAAATGTATGAG
GGGACAGTGGAAGAAAACCAGGTCAATGTAGAAGTCATGCGGATCAAAGTGACCGATGCAGATGAAGTGG
GCTCTGATAACTGGCTAGCAAACTTTACATTTGCATCAGGAAATGAAGGGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5355674), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57814. Forward Primer - name:057814_F_IRAV87_g10_Dsg2, sequence:TCGTCAAAAGAGGGCCTG; Reverse Primer - name:057814_R_SP6_IRAV87_g10_Dsg2, sequence:AGCCCCCTTCATTTCCTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12880 same embryo
 EMAGE:12882 same embryo
 EMAGE:12879 same embryo
 EMAGE:12878 same embryo
 EMAGE:12877 same embryo
 EurExpress:euxassay_013590 same experiment
 MGI:4824399 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS