Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12896

Actl6a actin-like 6A ( MGI:1861453)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896
"Pseudo-wholemount" of euxassay_013581. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013581_01 euxassay_013581_02 euxassay_013581_03 euxassay_013581_04
EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896
euxassay_013581_05 euxassay_013581_06 euxassay_013581_07 euxassay_013581_08 euxassay_013581_09
EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896
euxassay_013581_10 euxassay_013581_11 euxassay_013581_12 euxassay_013581_13 euxassay_013581_14
EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896 EMAGE:12896
euxassay_013581_15 euxassay_013581_16 euxassay_013581_17 euxassay_013581_18 euxassay_013581_19
EMAGE:12896 EMAGE:12896 EMAGE:12896
euxassay_013581_20 euxassay_013581_21 euxassay_013581_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12896Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12896_wholemount_strong.wlz
12896_wholemount_moderate.wlz
12896_wholemount_weak.wlz
12896_wholemount_possible.wlz
12896_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12896_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19 20
vibrissa
moderate moderate
regionalmoderate expression: see section 04 05 06 19 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20 21 22
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
anterior naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13
external naris epithelium
moderate moderate
regionalmoderate expression: see section 10 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 18 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 17 18 19 20 21
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30166
Entity Detected:Actl6a, actin-like 6A ( MGI:1861453)
Sequence:sense strand is shown

>T30166
TCGAGAAGGCTCTCCAGCCAACTGGAAAAGAAAAGAGAAACTGCCCCAGGTTACAAGGTCTTGGCACAAT
TACATGTGCAACTGCGTCATCCAGGATTTTCAAGCTTCCGTTCTTCAGGTGTCAGACTCCACCTACGACG
AACAAGTGGCTGCACAGATGCCGACCGTTCACTACGAATTCCCCAACGGCTACAACTGCGATTTTGGGGC
AGAGCGGCTGAAAATTCCTGAAGGGTTATTTGACCCTTCGAACGTAAAGGGACTGTCTGGGAACACGATG
CTGGGAGTCAGTCACGTTGTCACAACCAGCGTCGGAATGTGTGACATCGACATCAGACCAGGTCTCTACG
GCAGTGTGATCGTAGCAGGAGGAAACACGCTAATACAGAGTTTCACTGACAGGTTAAATAGAGAGCTTTC
TCAGAAAACTCCACCAAGTATGCGGTTGAAACTGATTGCAAACAACACGACGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3491205), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 10245. Forward Primer - name:010245_F_IRAV04-07_A14_C79802, sequence:TCGAGAAGGCTCTCCAGC; Reverse Primer - name:010245_R_SP6_IRAV04-07_A14_C79802, sequence:CACCGTCGTGTTGTTTGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4822956 same experiment
 EurExpress:euxassay_013581 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS