Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12918

Jup junction plakoglobin ( MGI:96650)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918
"Pseudo-wholemount" of euxassay_013744. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013744_01 euxassay_013744_02 euxassay_013744_03 euxassay_013744_04
EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918
euxassay_013744_05 euxassay_013744_06 euxassay_013744_07 euxassay_013744_08 euxassay_013744_09
EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918
euxassay_013744_10 euxassay_013744_11 euxassay_013744_12 euxassay_013744_13 euxassay_013744_14
EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918
euxassay_013744_15 euxassay_013744_16 euxassay_013744_17 euxassay_013744_18 euxassay_013744_19
EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918 EMAGE:12918
euxassay_013744_20 euxassay_013744_21 euxassay_013744_22 euxassay_013744_23 euxassay_013744_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12918Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12918_wholemount_strong.wlz
12918_wholemount_moderate.wlz
12918_wholemount_weak.wlz
12918_wholemount_possible.wlz
12918_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12918_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 16 17 18 19
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 19
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 09
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 17 18 19 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 18 19 20 21 22 23 24
cornea epithelium
strong strong
regionalstrong expression: see section 03 04 22 23 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
anterior naris epithelium
strong strong
regionalstrong expression: see section 11 12 14 15
external naris epithelium
strong strong
regionalstrong expression: see section 10 11 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 14 15 16 17 18
esophagus epithelium
strong strong
regionalstrong expression: see section 14 15
pharynx epithelium
strong strong
regionalstrong expression: see section 14 15 16
tongue epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
stomach
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
rectum
strong strong
regionalstrong expression: see section 14
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 17 moderate expression: see section 15 16 18 19 20
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 15 16 17
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 19 20
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 15 16
upper jaw molar
strong strong
regionalstrong expression: see section 06 20
bladder
strong strong
regionalstrong expression: see section 13 14 15
urethra of male
strong strong
regionalstrong expression: see section 14
larynx
strong strong
regionalstrong expression: see section 13 14 15
trachea epithelium
strong strong
regionalstrong expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T32048
Entity Detected:Jup, junction plakoglobin ( MGI:96650)
Sequence:sense strand is shown

>T32048
CCTGGTGCAGAACTGCCTGTGGACTCTGCGCAATCTCTCGGATGTAGCCACCAAGCAGGAGGGCCTGGAG
AGTGTGCTGAAGATCCTGGTCAACCAACTGAGTGTAGATGACGTCAACGTCCTCACCTGTGCCACGGGCA
CCCTCTCCAACCTGACCTGCAACAACAGCAAAAACAAGACGCTGGTGACACAGAACAGTGGCGTGGAGGC
GCTCATCCACGCCATCCTGAGAGCCGGAGACAAAGATGACATCACAGAGCCCGCTGTCTGTGCCCTGCGC
CACCTTACCAGCCGTCACCCCGAGGCTGAGATGGCCCAGAACTCTGTGCGCCTCAACTATGGAATCCCGG
CCATTGTGAAACTGCTCAACCAGCCAAACCAGTGGCCACTGGTCAAGGCAACTATTGGCCTGATCCGGAA
CCTGGCTCTGTGCCCAGCCAACCATGCCCCTCTGCAGGAGGCCGCGGTCATTCCCCGCCTCGTCCAGCTG
TTGGTCAAGGCCCACCAGGACGCCCAGCGCCATGTGGCTGCAGGCACCCAGCAGCCCTACACGGATGGTG
TGAGGATGGAGGAGATCGTGGAAGGCTGCACCGGAGCCCTGCACATCCTCGCCCGGGATCCCATGAACCG
CATGGAGATCTTCCGGCTCAACACCATTCCCCTGTTTGTCCAGCTCCTGTACTCCTCTGTGGAGAACATC
CAGCGTGTGGCTGCGGGAGTGCTCTGCGAGCTGGCCCAGGACAAGGAGGCTGCCGACGCCATTGATGCGG
AGGGCGCCTCTGCCCCTCTCATGGAGCTACTCCATTCCCGCAATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4216772), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57925. Forward Primer - name:057925_F_IRAV88_d10_Jup, sequence:CCTGGTGCAGAACTGCCT; Reverse Primer - name:057925_R_SP6_IRAV88_d10_Jup, sequence:TCATTGCGGGAATGGAGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12917 same embryo
 EurExpress:euxassay_013744 same experiment
 MGI:4825685 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS