Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12962

Leprel1 leprecan-like 1 ( MGI:2146663)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962
"Pseudo-wholemount" of euxassay_013656. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013656_01 euxassay_013656_02 euxassay_013656_03 euxassay_013656_04
EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962
euxassay_013656_05 euxassay_013656_06 euxassay_013656_07 euxassay_013656_08 euxassay_013656_09
EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962
euxassay_013656_10 euxassay_013656_11 euxassay_013656_12 euxassay_013656_13 euxassay_013656_14
EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962 EMAGE:12962
euxassay_013656_15 euxassay_013656_16 euxassay_013656_17 euxassay_013656_18 euxassay_013656_19
EMAGE:12962 EMAGE:12962 EMAGE:12962
euxassay_013656_20 euxassay_013656_21 euxassay_013656_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12962Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12962_wholemount_strong.wlz
12962_wholemount_moderate.wlz
12962_wholemount_weak.wlz
12962_wholemount_possible.wlz
12962_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12962_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk mesenchyme
weak weak
regionalweak expression: see section 01 02 03 04 05 06 15 17 18 19 20 21 22
diencephalon roof plate
weak weak
regionalweak expression: see section 11
telencephalon ventricular layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 15 16 17 18 19
spinal cord roof plate
strong strong
regionalstrong expression: see section 11 moderate expression: see section 13 weak expression: see section 12
tongue muscle
weak weak
regionalweak expression: see section 10 11 12 13 14
mandible
weak weak
regionalweak expression: see section 02 03 04 06 07 18 20 21
metanephros
moderate moderate
regionalmoderate expression: see section 07 18
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 11 12
clavicle
strong strong
regionalstrong expression: see section 08 09 15 moderate expression: see section 07 16 weak expression: see section 17
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37779
Entity Detected:Leprel1, leprecan-like 1 ( MGI:2146663)
Sequence:sense strand is shown

>T37779
TTCCCTTGCATTACGACTACCTCCAGTTTGCCTACTACAGAGTTGGTGAATATGTGAAAGCCTTGGAGTG
CGCCAAAGCCTACCTGATGTTCCATCCAGACAATGAGGATGTCCTGGACAATGTAGACTTCTATGAGAGT
CTGCTGGATGACAGCACTGATCCAGCATCCATTGAGGCCCGGGAGGATTTAACAGCATTTGTCAAACGTC
ATAAACTTGAAGCTGAACTGATCAAGTTAGCTGCAGAGGGCCTGGGATTTTCATATGCTGAACCGAATTA
CTGGATCAGCTATGGAGGACGGCAGGATGAGAACCGAGTCCCTTCAGGAGTGAATATGGATGGGGCAGAA
GTTCATGGATTGTCAATGGGAAAGAAGTCACCGCCCAAGATAGGTCGAGACCTAAGAGAAGGTGGCCCTC
TGCTCTACGAGAACATCACCTTCGTCTACAACTCTGAGCAGCTGAACGGGACTCAACGGGTTCTTCTCGA
TAATGTCCTGTCGCAAGAGCAGTGTCGGGAGCTGCACAGTGTGGCCAATGGAATCATGCTGGTTGGTGAT
GGATACCGAGGGAAAACGTCACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88711. Forward Primer - name:088711_F_cDNA_Leprel1, sequence:TTCCCTTGCATTACGACTACCT; Reverse Primer - name:088711_N_SP6_cDNA_Leprel1, sequence:GGTGACGTTTTCCCTCGGTAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12964 same embryo
 EMAGE:12963 same embryo
 EMAGE:12965 same embryo
 EurExpress:euxassay_013656 same experiment
 MGI:4825902 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS