Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13015

Slc44a5 solute carrier family 44, member 5 ( MGI:3035141)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015
"Pseudo-wholemount" of euxassay_019725. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019725_01 euxassay_019725_02 euxassay_019725_03 euxassay_019725_04
EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015
euxassay_019725_05 euxassay_019725_06 euxassay_019725_07 euxassay_019725_08 euxassay_019725_09
EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015
euxassay_019725_10 euxassay_019725_11 euxassay_019725_12 euxassay_019725_13 euxassay_019725_14
EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015
euxassay_019725_15 euxassay_019725_16 euxassay_019725_17 euxassay_019725_18 euxassay_019725_19
EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015 EMAGE:13015
euxassay_019725_20 euxassay_019725_21 euxassay_019725_22 euxassay_019725_23 euxassay_019725_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13015Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13015_wholemount_strong.wlz
13015_wholemount_moderate.wlz
13015_wholemount_weak.wlz
13015_wholemount_possible.wlz
13015_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13015_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 17 18 19 20 weak expression: see section 09 16
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 20 21 22 23 24 weak expression: see section 04 08 09 10 11 12 13 17 18 19
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 22 23 24 weak expression: see section 04 08 09 10
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 09 21
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 17 18
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 09 10 12 13 15 16 17 21 22 23 weak expression: see section 19 20
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 18
pons mantle layer
weak weak
regionalweak expression: see section 08 09 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 08 19 20
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 moderate expression: see section 10 12 13 15 16 17 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 09 19 20 21
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
lower lip
weak weak
regionalweak expression: see section 09 10 11 12 20 21
upper lip
weak weak
regionalweak expression: see section 09 10 11 12 21
trachea
weak weak
regionalweak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T56048
Entity Detected:Slc44a5, solute carrier family 44, member 5 ( MGI:3035141)
Sequence:sense strand is shown

>T56048
GAGCTGCCAGTCAGTCCTTCAGCCCTTACCACTCAATTCTCTCAGTGCCTTCCTGGCTGGTCAGTACTTC
CCGGATCTTGTGAGCAAGTGGACAGACCTCGTTTGAAAGAAATTAAACTTTAAACCCTGCAATGCTGAGT
GATGACAAGTCTCATGCTTCTTTTGTTTTGTTATTTTTGTTTTGTTTTTGATGTTTTGTTTGGCTTTGTT
TTGTTTTGTCTTGCTCACTGACTGGACTCCACTAGCCATGACACTACCTTTGATATCCTCCTCATCAAAG
GAGTACACTGTGTGATACAAACAATTCCCCTTGTGCCTAGTGGATATTCACAAATGGGTGCCACACGCAA
CACGCAACACGCAAAGCAGCCTGAACGAACATGTGTTGGATTTGTCTTTGTTTTTACTAAAAGAAGTTTT
AAAGTATAATCTTTTCTATAGCGGTTCCTTTGAAATATGGGTCGGCATGCACACGTCTGGTGTCTCACCC
ATACCTGAAGGGGAAGCCTGTGGGAGTTTCACAGGGCAACTTTCCCTCTGAGGGGAAGCTGTGTGCTGGG
CTGGAAAGCCCCATTACCTGTGGCTCTTCTATCCTGTTATGGATTGTCAGTTCCACTAACTTTTATACGA
AACAACCTGTTTACCTGTCAGTTTTTTATTGTGCCAATAGAAACTGGAACGGTTTTTAATTCAGTTTTGA
ATAATTTTATGAGGATTGCTAAGTTTTAGGAGAACTTGACTCAGTTCACCAACTCAGCAAGTCACCCGAG
AAGGGGATCAGTGAGAGTCAATCAACAATACCTACTGTTGTTTATTGATGGTTTGTTGAAAACTCACTTT
AGATACCTTTATACCAAAAAGCTCCCACTGGCGCCTTGCAGTGTGGGCTCACCACCCCCTACCCCCACCC
CACGCCACGCCTGGTGGTTTGGGCTCTGCTGAGCCCATGGTGGTGTGGGTTGTGTAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GAGCTGCCAGTCAGTCCTTC; Reverse Primer - name:unspecified, sequence:CTACACAACCCACACCACCA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13014 same embryo
 EurExpress:euxassay_019725 same experiment
 MGI:4828235 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS