Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13045

Thsd7a thrombospondin, type I, domain containing 7A ( MGI:2685683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045
"Pseudo-wholemount" of euxassay_013737. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013737_01 euxassay_013737_02 euxassay_013737_03 euxassay_013737_04
EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045
euxassay_013737_05 euxassay_013737_06 euxassay_013737_07 euxassay_013737_08 euxassay_013737_09
EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045
euxassay_013737_10 euxassay_013737_11 euxassay_013737_12 euxassay_013737_13 euxassay_013737_14
EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045
euxassay_013737_15 euxassay_013737_16 euxassay_013737_17 euxassay_013737_18 euxassay_013737_19
EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045 EMAGE:13045
euxassay_013737_20 euxassay_013737_21 euxassay_013737_22 euxassay_013737_23 euxassay_013737_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13045Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13045_wholemount_strong.wlz
13045_wholemount_moderate.wlz
13045_wholemount_weak.wlz
13045_wholemount_possible.wlz
13045_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13045_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 24
forelimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 24
forelimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 24
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 23 24
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 23 24
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 23 24
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 23 24
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 23 24
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 07 08 09 10 11 12 14 15 16 17 18 19 20 24 moderate expression: see section 03 04 05 06 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 09 10 11 12 13 14 15 16 17 18
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 08
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 20 21
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 08
pons mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 16 17 18 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 15 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
nasal cavity olfactory epithelium
strong strong
single cellstrong expression: see section 08 09 11 12 15 16 18 19
stomach
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
kidney calyx
strong strong
single cellstrong expression: see section 07 08 17 18
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37848
Entity Detected:Thsd7a, thrombospondin, type I, domain containing 7A ( MGI:2685683)
Sequence:sense strand is shown

>T37848
GAAAACCACAGAAGGGAAACAGACCCGAGCCCGGTCAATTTTGGCCTATGCAGGTGAAGAAGGTGGAATT
CGCTGCCCTAACATCAGTGCTTTGCAAGAGGTGCGCAGCTGCAATGAGCATCCTTGCACTGTGTACCACT
GGCAAACTGGTCCCTGGGGTCAGTGTATAGAGGACACATCGGTGTCATCCTTCAATACGACCACAACATG
GAATGGGGAGGCCTCATGTTCTGTGGGCATGCAGACACGAAAAGTCATCTGTGTGCGAGTCAACGTGGGC
CAAGTGGGACCTAAGAAGTGTCCTGAAAGCCTTCGGCCTGAAACAGTGAGACCCTGCTTGCTTCCTTGTC
GGAAGGACTGTGTCGTGACCCCATACAGTGACTGGACTCCATGCCCCTCTTCATGCAGAGAAGGAGACTC
TGGAGCCAGGAAGCAGTCTCGACAGCGAGTCATCATTCAGCTGCCAGCCAATGGCGGCAAGGAATGCTCA
GACCCACTATATGAAGAGAAGGCCTGTGAAGCCCCTCCCACATGTCACAGCTACAGGTGGAAGACACACA
AATGGCGCAGGTGCCAGTTAGTTCCTTGGAGCATTCAACAGGATGTTCCTGGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79238. Forward Primer - name:079238_F_cDNA_LOC330267, sequence:GAAAACCACAGAAGGGAAACAG; Reverse Primer - name:079238_N_SP6_cDNA_LOC330267, sequence:GCTCCAGGAACATCCTGTTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13044 same embryo
 EMAGE:13042 same embryo
 EMAGE:13043 same embryo
 EurExpress:euxassay_013737 same experiment
 MGI:4828706 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS