Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1314

Foxn4 forkhead box N4 ( MGI:2151057)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:1314
0030a.jpg This embryo was treated with ProteinaseK for 3min.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:1314Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
1314_wholemount_strong_3D_1.wlz
1314_wholemount_moderate_3D_1.wlz
1314_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:1314_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
midbrain
detected detected
regionalExpression was detected in dorsal mesencephalon.
hindbrain
detected detected
regionalExpression was detected in ventral rhombencephalon.
future spinal cord
detected detected
regionalExpression was detected in ventral spinal cord.
eye
detected detected
The tissue was optic vesicle.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3505927
Entity Detected:Foxn4, forkhead box N4 ( MGI:2151057)
Notes:Fragment size is 724nt. Primers used generate the template were : 5' - cgcggatccaggtcaaggtcaagccccaagc 3' - cccaagcttctgcagggggttcttgccaggc
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Yu J., Tenzen T., Gray P.A., Fu H., Luo P., Zhao Q., Ferrari A., Yuk D.I., Tsung E.F., Cai Z., Alberta J.A., Cheng L.P., Liu Y., Stenman J.M., Valerius M.T., Billings N., Kim H.A., Greenberg M.E., Rowitch D.H., Stiles C.D., Ma Q., McMahon A.P. Indexed by GXD, Spatially mapped by EMAGE.
Principal investigator:Andrew P. McMahon, Molecular and Cellular Biology, Harvard, Department of Molecular and Cellular Biology Harvard University 16 Divinity Ave Room 1059, Cambridge, U.S.A MA 02138
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1126/science.1104935] [ PMID:15618518] Gray PA, 2004 Mouse brain organization revealed through direct genome-scale TF expression analysis. Science (306):2255-7
Acknowledgments:This work was supported by the Charles Dana Foundation, the National Institute of Neurological Disorders and Stroke (QM, CDS, DHR & APM), the National Institute of Dental and Craniofacial Research (QM), the National Institute of Diabetes and Digestive and Kidney Diseases (APM), a Ford Foundation Postdoctoral Fellowship for Minorities (PAG), a Parker B. Francis Fellowship in Pulmonary Medicine (PAG) and the Pew Trust (QM).
Links:MGI:3508651 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE