Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13467

Mterfd1 MTERF domain containing 1 ( MGI:1913660)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467
"Pseudo-wholemount" of euxassay_017766. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_017766_01 euxassay_017766_02 euxassay_017766_03 euxassay_017766_04
EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467
euxassay_017766_05 euxassay_017766_06 euxassay_017766_07 euxassay_017766_08 euxassay_017766_09
EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467
euxassay_017766_10 euxassay_017766_11 euxassay_017766_12 euxassay_017766_13 euxassay_017766_14
EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467
euxassay_017766_15 euxassay_017766_16 euxassay_017766_17 euxassay_017766_18 euxassay_017766_19
EMAGE:13467 EMAGE:13467 EMAGE:13467 EMAGE:13467
euxassay_017766_20 euxassay_017766_21 euxassay_017766_22 euxassay_017766_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13467Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13467_wholemount_strong.wlz
13467_wholemount_moderate.wlz
13467_wholemount_weak.wlz
13467_wholemount_possible.wlz
13467_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13467_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T269
Entity Detected:Mterfd1, MTERF domain containing 1 ( MGI:1913660)
Sequence:sense strand is shown

>T269
GGCGTAGGTTGCACGGTCGCTGTGAAGCAGGAGCGCGAGACCGCCGCCCGGCCGGATTACTGTCCGGCCT
ACCTGTACCCAGCAGAGTCCGGGAGCCTCGCGGCTTGACTAAAATGTCAAAAAGAAAATGGCTCTGTTAG
CCCAACAGTTACCCAGACGGTTCAACTCAGTTAAGTTGACTAGCTTCATTAAAGCCAAACAAGTCACCAA
ACGCTCTGCAAGAGCAGGAAAAGCCGTGTTGCCCGGCTTCTCAGCTCAGCCTCTGCTCTCCTCTGACACG
AGCTTTCTCCGGCGGGGAATTAAGACTTACAGGACTTTGTTCTGGAATCGTTTCCATTCTGCCAGCACAA
ATAGGACAAAGAGTTCTGCCGAAAGCACTCTGCTTCCTTCAGTGGCTGAACAGCAGGAGAGGATACTTAG
TCTTGAATCAGAGCTGCCTCTTGAAGAAGTGGATGACCTGCCTCCATTGTCTCCGTTACAGTCAGTTTCA
Notes:The probe template was PCR amplified from IMAGE:2655114 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655114 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13465 same embryo
 EMAGE:13468 same embryo
 EMAGE:13470 same embryo
 EMAGE:13466 same embryo
 EMAGE:13469 same embryo
 EurExpress:euxassay_017766 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS