Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13593

Mir448 microRNA 448 ( MGI:3619406)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593
"Pseudo-wholemount" of euxassay_019191. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019191_01 euxassay_019191_02 euxassay_019191_03 euxassay_019191_04
EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593
euxassay_019191_05 euxassay_019191_06 euxassay_019191_07 euxassay_019191_08 euxassay_019191_09
EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593
euxassay_019191_10 euxassay_019191_11 euxassay_019191_12 euxassay_019191_13 euxassay_019191_14
EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593
euxassay_019191_15 euxassay_019191_16 euxassay_019191_17 euxassay_019191_18 euxassay_019191_19
EMAGE:13593 EMAGE:13593 EMAGE:13593 EMAGE:13593
euxassay_019191_20 euxassay_019191_21 euxassay_019191_22 euxassay_019191_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13593Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13593_wholemount_strong.wlz
13593_wholemount_moderate.wlz
13593_wholemount_weak.wlz
13593_wholemount_possible.wlz
13593_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13593_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 19 weak expression: see section 04 09 10 14 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 21 22 moderate expression: see section 04 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 13 16 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70024
Entity Detected:Mir448, microRNA 448 ( MGI:3619406)
Sequence:sense strand is shown

>T70024
TTGCATATGTAGGATGTCCCAT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-448 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13591 same embryo
 EMAGE:13592 same embryo
 EMAGE:13590 same embryo
 EurExpress:euxassay_019191 same experiment
 MGI:4826285 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS