Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13600

Mir151 microRNA 151 ( MGI:2676836)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600
euxassay_019209_01 euxassay_019209_02 euxassay_019209_03 euxassay_019209_04 euxassay_019209_05
EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600
euxassay_019209_06 euxassay_019209_07 euxassay_019209_08 euxassay_019209_09 euxassay_019209_10
EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600
euxassay_019209_11 euxassay_019209_12 euxassay_019209_13 euxassay_019209_14 euxassay_019209_15
EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600
euxassay_019209_16 euxassay_019209_17 euxassay_019209_18 euxassay_019209_19 euxassay_019209_20
EMAGE:13600 EMAGE:13600 EMAGE:13600 EMAGE:13600
euxassay_019209_21 euxassay_019209_22 euxassay_019209_23 euxassay_019209_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13600Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13600_wholemount_strong.wlz
13600_wholemount_moderate.wlz
13600_wholemount_weak.wlz
13600_wholemount_possible.wlz
13600_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13600_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70282
Entity Detected:Mir151, microRNA 151 ( MGI:2676836)
Sequence:sense strand is shown

>T70282
CTAGACTGAGGCTCCTTGAGG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-151-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13602 same embryo
 EMAGE:13601 same embryo
 EurExpress:euxassay_019209 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS