Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13614

Mir455 microRNA 455 ( MGI:3629649)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614
"Pseudo-wholemount" of euxassay_019183. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019183_01 euxassay_019183_02 euxassay_019183_03 euxassay_019183_04
EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614
euxassay_019183_05 euxassay_019183_06 euxassay_019183_07 euxassay_019183_08 euxassay_019183_09
EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614
euxassay_019183_10 euxassay_019183_11 euxassay_019183_12 euxassay_019183_13 euxassay_019183_14
EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614
euxassay_019183_15 euxassay_019183_16 euxassay_019183_17 euxassay_019183_18 euxassay_019183_19
EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614 EMAGE:13614
euxassay_019183_20 euxassay_019183_21 euxassay_019183_22 euxassay_019183_23 euxassay_019183_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13614Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13614_wholemount_strong.wlz
13614_wholemount_moderate.wlz
13614_wholemount_weak.wlz
13614_wholemount_possible.wlz
13614_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13614_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
exoccipital bone
weak weak
regionalweak expression: see section 05 06 07 08 22 23 24
temporal bone
weak weak
regionalweak expression: see section 02 03 04 05 06 07 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 20 21 weak expression: see section 02 03 04 06 07 08 09 19
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70035
Entity Detected:Mir455, microRNA 455 ( MGI:3629649)
Sequence:sense strand is shown

>T70035
GCAGTCCACGGGCATATACAC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-455 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13615 same embryo
 EMAGE:13613 same embryo
 EMAGE:13616 same embryo
 EMAGE:13612 same embryo
 EMAGE:13617 same embryo
 EurExpress:euxassay_019183 same experiment
 MGI:4826294 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS