Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13619

Klf2 Kruppel-like factor 2 (lung) ( MGI:1342772)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619
"Pseudo-wholemount" of euxassay_019501. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019501_01 euxassay_019501_02 euxassay_019501_03 euxassay_019501_04
EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619
euxassay_019501_05 euxassay_019501_06 euxassay_019501_07 euxassay_019501_08 euxassay_019501_09
EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619
euxassay_019501_10 euxassay_019501_11 euxassay_019501_12 euxassay_019501_13 euxassay_019501_14
EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619
euxassay_019501_15 euxassay_019501_16 euxassay_019501_17 euxassay_019501_18 euxassay_019501_19
EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619 EMAGE:13619
euxassay_019501_20 euxassay_019501_21 euxassay_019501_22 euxassay_019501_23 euxassay_019501_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13619Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13619_wholemount_strong.wlz
13619_wholemount_moderate.wlz
13619_wholemount_weak.wlz
13619_wholemount_possible.wlz
13619_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13619_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 09 10 11 21 22 23 weak expression: see section 08 12 17 19 20 24
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 23
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 22
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 22 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01 22
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 01 02 21 22 23
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 01 02 22
foot mesenchyme
strong strong
regionalstrong expression: see section 23 moderate expression: see section 01
otic capsule
strong strong
regionalstrong expression: see section 10 11 17 18 19 moderate expression: see section 09 20
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13 14 weak expression: see section 15 16
endocardial tissue
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
heart valve
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 13
mandible
moderate moderate
regionalmoderate expression: see section 04 05 07 08 18 19 21 22 23 weak expression: see section 06 09 10 17 20
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 13 14 weak expression: see section 12
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15
maxilla
moderate moderate
regionalmoderate expression: see section 05 08 18 19 21 weak expression: see section 06 09 10 17 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15
axial skeleton
weak weak
regionalweak expression: see section 10 11 13 14 15 16 17 18
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 05 06 21 22 weak expression: see section 04
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 07 08 22 23 24 weak expression: see section 04 05 06 18 19 20 21
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 10 11 18 weak expression: see section 19
pelvic girdle skeleton
weak weak
regionalweak expression: see section 09 10 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55092
Entity Detected:Klf2, Kruppel-like factor 2 (lung) ( MGI:1342772)
Sequence:sense strand is shown

>T55092
AGGTTCCACGCGCGGGGCACGGTCCCCTTGCAAACAGACTGCTATTTATTGGACCTTAGGACAGAGCCGG
ACAAGTGTGGCCACAGGAAAATGACTCTGCCACCAGTTCTGGCCCCACAGTGACTGAAGGCCCCAGGAAA
GAAGACAGGAGTCTGTGAAGATGTTTTCAAAATGGTGCAATAATTGACTTATTTCCCTCGGGTCCCCACT
AGAGGATCGAGGCTAGATGCCTTGTGAGAAATGCCTTTGAGTTTACTGTCCCCAACGTTTTTATAATATT
GTATATAAGACTATGACCGATTGTATTTCTATAAGGGAGACGATGGCATCTCTGCCGCCTGCTTCGTTTT
TAT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGTTCCACGCGCGGGGCACGG; Reverse Primer - name:unspecified, sequence:ATAAAAACGAAGCAGGCGGC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13618 same embryo
 EMAGE:13623 same embryo
 EMAGE:13622 same embryo
 EMAGE:13621 same embryo
 EMAGE:13620 same embryo
 EurExpress:euxassay_019501 same experiment
 MGI:4825782 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS