Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13622

Foxc2 forkhead box C2 ( MGI:1347481)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622
"Pseudo-wholemount" of euxassay_019498. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019498_01 euxassay_019498_02 euxassay_019498_03 euxassay_019498_04
EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622
euxassay_019498_05 euxassay_019498_06 euxassay_019498_07 euxassay_019498_08 euxassay_019498_09
EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622
euxassay_019498_10 euxassay_019498_11 euxassay_019498_12 euxassay_019498_13 euxassay_019498_14
EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622
euxassay_019498_15 euxassay_019498_16 euxassay_019498_17 euxassay_019498_18 euxassay_019498_19
EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622 EMAGE:13622
euxassay_019498_20 euxassay_019498_21 euxassay_019498_22 euxassay_019498_23 euxassay_019498_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13622Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13622_wholemount_strong.wlz
13622_wholemount_moderate.wlz
13622_wholemount_weak.wlz
13622_wholemount_possible.wlz
13622_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13622_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 weak expression: see section 23 24
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 24 weak expression: see section 23
hand mesenchyme
weak weak
regionalweak expression: see section 01
hindlimb digit 1 metatarsal
moderate moderate
regionalmoderate expression: see section 01 22 23
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 01
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 01 22 23
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 01 22 23 weak expression: see section 02
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 22 23
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 22
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 22
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 01 02 03 21 22 23
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 01 02 22
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 24
otic capsule
moderate moderate
regionalmoderate expression: see section 09 10 11 17 18 19 20
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 05 24
cornea
moderate moderate
regionalmoderate expression: see section 23 weak expression: see section 01 02 03 04
metanephros
strong strong
regionalstrong expression: see section 09 10 11 17 18 19 20 21 weak expression: see section 08 12
male reproductive system
weak weak
regionalweak expression: see section 12 15
exoccipital bone
moderate moderate
regionalmoderate expression: see section 07
temporal bone
moderate moderate
regionalmoderate expression: see section 05 06 07 22 23 weak expression: see section 03 04
orbito-sphenoid
weak weak
regionalweak expression: see section 04 05 08 09 12 19
viscerocranium
weak weak
regionalExpression in the turbinate bone.
pelvic girdle skeleton
weak weak
regionalweak expression: see section 09 10 17 18 19
axial skeleton tail region
weak weak
regionalweak expression: see section 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55049
Entity Detected:Foxc2, forkhead box C2 ( MGI:1347481)
Sequence:sense strand is shown

>T55049
CAGAACCAGGAGCAGAGAGCTCCGTGCAACTCGCAGGTAACTTATCCGCAGCTCAGTTTGAGATCTCAGC
GAGTCCCTCTAAGGGGGATGCAGCCCAGCAAAACGAAATACAGATTTTTTTTTTAATTCCTTCCCCTACC
CAGATGCTGCGCCTGCTCCCTTGGGGCTTCATAGATTAGCTTATGGACCAAACCCATAGGGACCCCTAAT
GACTTCTGTGGAGATTCTCCACGGGCGCAAGAGGTCTCTCCGGATAAGGTGCCTTCTGTAAACGAGTGCG
GATTTGTAACCAGGCTATTTTGTTCTTGCCCAGAGCCTTTAATATAATATTTAAAGTTGTGTCCACTGGA
TAAGGTTTCGTCTTGCCCAACTGTTACTGCCAAATTGAATTCAAGAAACGTGTGTGGGTCTTTTCTCCCC
ACGTCACCATGATAAAATAGGTCCCTCCCCAAACTG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CAGAACCAGGAGCAGAGAGC; Reverse Primer - name:unspecified, sequence:CAGTTTGGGGAGGGACCTAT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13618 same embryo
 EMAGE:13623 same embryo
 EMAGE:13619 same embryo
 EMAGE:13621 same embryo
 EMAGE:13620 same embryo
 EurExpress:euxassay_019498 same experiment
 MGI:4824899 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS