Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13644

Zfp143 zinc finger protein 143 ( MGI:1277969)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644
"Pseudo-wholemount" of euxassay_019510. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019510_01 euxassay_019510_02 euxassay_019510_03 euxassay_019510_04
EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644
euxassay_019510_05 euxassay_019510_06 euxassay_019510_07 euxassay_019510_08 euxassay_019510_09
EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644
euxassay_019510_10 euxassay_019510_11 euxassay_019510_12 euxassay_019510_13 euxassay_019510_14
EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644
euxassay_019510_15 euxassay_019510_16 euxassay_019510_17 euxassay_019510_18 euxassay_019510_19
EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644 EMAGE:13644
euxassay_019510_20 euxassay_019510_21 euxassay_019510_22 euxassay_019510_23 euxassay_019510_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13644Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13644_wholemount_strong.wlz
13644_wholemount_moderate.wlz
13644_wholemount_weak.wlz
13644_wholemount_possible.wlz
13644_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13644_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55218
Entity Detected:Zfp143, zinc finger protein 143 ( MGI:1277969)
Sequence:sense strand is shown

>T55218
GTTCAGCATGTCCCCATACCTAAAAGTAGGGACAGTTTGCGGCTGGAGGATGGGCAAGCAGTGCAGCTAG
AAGACGGGACCACTGCATTTATCCACCACACCTCGAAAGACAGTTATGACCAGAGCTCACTTCAGGCCGT
TCAGTTAGAAGATGGGACAACAGCTTATATCCACCATGCAGTGCAAGTCCCACAGTCTGA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GTTCAGCATGTCCCCATACC; Reverse Primer - name:unspecified, sequence:TCAGACTGTGGGACTTGCAC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13645 same embryo
 EurExpress:euxassay_019510 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS