Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13708

Supt16h suppressor of Ty 16 homolog (S. cerevisiae) ( MGI:1890948)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708
"Pseudo-wholemount" of euxassay_019556. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019556_01 euxassay_019556_02 euxassay_019556_03 euxassay_019556_04
EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708
euxassay_019556_05 euxassay_019556_06 euxassay_019556_07 euxassay_019556_08 euxassay_019556_09
EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708
euxassay_019556_10 euxassay_019556_11 euxassay_019556_12 euxassay_019556_13 euxassay_019556_14
EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708
euxassay_019556_15 euxassay_019556_16 euxassay_019556_17 euxassay_019556_18 euxassay_019556_19
EMAGE:13708 EMAGE:13708 EMAGE:13708 EMAGE:13708
euxassay_019556_20 euxassay_019556_21 euxassay_019556_22 euxassay_019556_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13708Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13708_wholemount_strong.wlz
13708_wholemount_moderate.wlz
13708_wholemount_weak.wlz
13708_wholemount_possible.wlz
13708_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13708_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 20 21 moderate expression: see section 01 02 19
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 21 moderate expression: see section 01 02 19 20
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 02 19 20
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 02 03 19 20
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 20 moderate expression: see section 02 03 19
thymus primordium
strong strong
regionalstrong expression: see section 12 13 14 15 16
sublingual gland primordium
strong strong
regionalstrong expression: see section 08 09 10 16 17 18
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 weak expression: see section 12 17
vibrissa
strong strong
regionalstrong expression: see section 05 06 19 20 moderate expression: see section 03 04 22
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 10 11 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 14 15
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 02
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 05 06 07 08 15 19 20 21 moderate expression: see section 09 10 11 12 13 16 17 18
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 15 19 20 21 moderate expression: see section 09 11 13
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 moderate expression: see section 19
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 14 15 16 weak expression: see section 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 11 13 14 15 16 17
vomeronasal organ
weak weak
regionalweak expression: see section 11
stomach
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03 05 06 07 08 09
hindgut
moderate moderate
regionalmoderate expression: see section 15 16
midgut
strong strong
regionalstrong expression: see section 09 10 11 13 14 moderate expression: see section 05 06 07 08 12 15 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metanephros
strong strong
regionalstrong expression: see section 20 moderate expression: see section 08 09 10 11 18 19
urethra of male
weak weak
regionalweak expression: see section 13 14
lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 03 04 20 21 22 moderate expression: see section 01 02 19
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55195
Entity Detected:Supt16h, suppressor of Ty 16 homolog (S. cerevisiae) ( MGI:1890948)
Sequence:sense strand is shown

>T55195
GGAACCACATATTCGGGAGATGAAGATCTATATTGATAAGAAATATGAGACTGTGATAATGCCTGTGTTT
GGCATTGCCACACCCTTCCATATTGCCACAATCAAGAACATAAGTATGTCTGTCGAAGGAGACTATACTT
ACTTGCGAATCAACTTCTATTGTCCAGGCAGTGCTCTGGGCAGGAATGAGGGCAACATCTTTCCTAACCC
TGAAGCCACTTTTGTCAAGGAAATTACATACCGAGCTTCAAATATGAAAGCACCTGGAGAGCAGACTGTA
CCCGCCTTAAATCTTCAGAATGCGTTCCGAATTATAAAAGAAGTACAAAAACGTTACAAGACCAGAGAAG
CTGAAGAGAAAGAAAAAGAGGGCATTGTAAAACAAGACTCGCTGGTGATCAACCTAAACCGGAGTAATCC
AAAACTGAAAGACCTGTACATTCGTCCAAACATTGCCCAGAAGAGAATGCAGGGCTCACTGGAGGCTCAT
GTCAATGGTTTCCGATTCACATCTGTTCGAGGAGACAAGGTGGATATTCTGTACAATAATATCAAGCATG
CGCTGTTCCAGCCCTGTGATGGCGAGATGATTATTGTTTTGCACTTTCACCTCAAGAATGCTATCATGTT
TGGGAAGAAGCGACACACAGATGTACAGTTCTACACAGAAGTTGGAGAGATCACTACAGATTTGGGGAAA
CATCAACACATGCATGACCGAGATGACCTGTATGCTGAGCAGATGGAACGAGAAATGAGACACAAACTGA
AAACGGCCTTTAAAAATTTCATTGAAAAAGTAGAGGCCCTAACAAAGGAGGAGCTGGAGTTTGAAGTGCC
ATTTAGGGACCTGGGGTTTAATGGGGCTCCCTACAGGAGTACCTGCCTCCTTCAGCCCACTAGTAGTGCC
CTGGTAAATGCTACAGAGTGGCCACCCTTTGTGGTGACACTGGATGAAGTGGAGCTGATCCATTTTGAGA
GGGTCCAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GGAACCACATATTCGGGAGA; Reverse Primer - name:unspecified, sequence:CTGGACCCTCTCAAAATGGA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13710 same embryo
 EMAGE:13709 same embryo
 EMAGE:13711 same embryo
 EurExpress:euxassay_019556 same experiment
 MGI:4828541 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS