Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13714

Mafg v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) ( MGI:96911)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714
"Pseudo-wholemount" of euxassay_019502. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019502_01 euxassay_019502_02 euxassay_019502_03 euxassay_019502_04
EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714
euxassay_019502_05 euxassay_019502_06 euxassay_019502_07 euxassay_019502_08 euxassay_019502_09
EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714
euxassay_019502_10 euxassay_019502_11 euxassay_019502_12 euxassay_019502_13 euxassay_019502_14
EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714
euxassay_019502_15 euxassay_019502_16 euxassay_019502_17 euxassay_019502_18 euxassay_019502_19
EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714 EMAGE:13714
euxassay_019502_20 euxassay_019502_21 euxassay_019502_22 euxassay_019502_23 euxassay_019502_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13714Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13714_wholemount_strong.wlz
13714_wholemount_moderate.wlz
13714_wholemount_weak.wlz
13714_wholemount_possible.wlz
13714_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13714_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 18 19
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 09 19 20 21 22
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 10 11 12 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 17 18 weak expression: see section 10
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 21 22 23
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 09 19 weak expression: see section 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 21 22 23 weak expression: see section 20
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 13 14 18 19 21 weak expression: see section 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 15 16 17
stomach
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11
midgut
moderate moderate
regionalmoderate expression: see section 17 18 19 weak expression: see section 06 07 08 09 10 11 13 14 15
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
lower jaw molar
weak weak
regionalweak expression: see section 07 08 19 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 19 20
liver
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
metanephros
weak weak
regionalweak expression: see section 11 12 13 21 22 23
testis
weak weak
regionalweak expression: see section 09 10 11 22 23 24
lung
weak weak
regionalweak expression: see section 09 10 11 12 13 14 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55101
Entity Detected:Mafg, v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian) ( MGI:96911)
Sequence:sense strand is shown

>T55101
AGACGGATGCTCGGTCATAGGGACACGTGCAGTTGCCAGGCAGGTCTTTGAGGGGCCACTAGGTGCGTGG
CAGAGTTGGCAGCCCCGTCCCTCTTCCTTTCATTTCCCTTCCTTTCTCCTCTCCCTTCCCTGTTTCCTTC
CCTGCAAAGCACAACCTGCACCCAGGGGCACTGGGCTGAGCCCCTTGATCATCTTCGTTGTCACGCCTGT
GTTTCGTACGTTGGGATCAGCCAGTTCAACAGTGATGTTGGGTTGCCCTTAACCCCTTTGTACCAAGGCC
GTGCAGGCTAGGAGTCCAGAGTGGGCGCTGTGGGAGTGGACGAGAGTGCACGTGGGCAAGTGTACTGGTC
TTGGGGCTGCCCTTGTCTCCCTGGTGGTCTGCAGTGGGATTTGAGCGCTTTCCTTTCAGAAGTCCAGTGG
GGCTCTCAGCTTAATCCAGAAGGAAGAGATGGGCTCTGCCCTGAAAAGTGGTTATGTCTTGACGCCCCTG
GGTGAATAGGCCACCAGCCTGGGCACTGGGGCAGGAACCATGGTGCTGGAGCCTGGCACAGTGCACCGGA
CAAGACCGAATCGCCGGTTATGAGTGTGGGTGGAAGGTGTGTCTGTGTGTCCGATGGGTCCGGTGTCACT
GTTTACATGACCTATTTGTGTGGTTATATAGCCCTTTATTTAAAAGAGAAGTTCCTTTTACGGAGTTATT
AAATTATATGTTTAAGAGCTAAAACGAAAAAAAAAAGCTGCAGAGTATTTATAAAATTGTCTTAAAAAAC
AAAAACAAAAACAAAAAAAACATTTGACCGTATACATGGAAAAGGGAAGAAAGTATAGTAGAAACTTTGC
TAGTTTAAAAAAAAAATCCCTTTCTTGTAAACCTGGGGACAGCGCTGTGGCTGTTGGAGTTTA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGACGGATGCTCGGTCATAG; Reverse Primer - name:unspecified, sequence:TAAACTCCAACAGCCACAGC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13715 same embryo
 EurExpress:euxassay_019502 same experiment
 MGI:4826058 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS