Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13752

Polr2b polymerase (RNA) II (DNA directed) polypeptide B ( MGI:2388280)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752
"Pseudo-wholemount" of euxassay_019551. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019551_01 euxassay_019551_02 euxassay_019551_03 euxassay_019551_04
EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752
euxassay_019551_05 euxassay_019551_06 euxassay_019551_07 euxassay_019551_08 euxassay_019551_09
EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752
euxassay_019551_10 euxassay_019551_11 euxassay_019551_12 euxassay_019551_13 euxassay_019551_14
EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752
euxassay_019551_15 euxassay_019551_16 euxassay_019551_17 euxassay_019551_18 euxassay_019551_19
EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752 EMAGE:13752
euxassay_019551_20 euxassay_019551_21 euxassay_019551_22 euxassay_019551_23 euxassay_019551_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13752Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13752_wholemount_strong.wlz
13752_wholemount_moderate.wlz
13752_wholemount_weak.wlz
13752_wholemount_possible.wlz
13752_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13752_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 13 14 15 weak expression: see section 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 18 19 moderate expression: see section 08 09 17
pancreas
weak weak
regionalweak expression: see section 10 11 12
thyroid gland
weak weak
regionalweak expression: see section 11 15
vibrissa
strong strong
regionalstrong expression: see section 05 21 moderate expression: see section 06 07 08 18 19 20
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 15 17 18 19 20 21 22 23 weak expression: see section 16
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 17 weak expression: see section 10 11 12 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 14 17 18 weak expression: see section 10 11 12 15 16
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 11
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 18 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24 weak expression: see section 16
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 18 19 20 21 22 weak expression: see section 12
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 14 15 17 18 19 20 21 22 23 weak expression: see section 12 13 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55148
Entity Detected:Polr2b, polymerase (RNA) II (DNA directed) polypeptide B ( MGI:2388280)
Sequence:sense strand is shown

>T55148
GCTTTGCGATTCCGAGTAAGAGCTCCAGAAACCTTTGGCCAAGATGTATGACGCCGACGAGGACATGCAA
TATGATGAAGACGACGATGAGATCACTCCGGATCTGTGGCAGGAAGCATGCTGGATCGTGATCAGTTCTT
ACTTTGATGAGAAAGGCTTGGTCAGACAACAGCTGGATTCCTTTGATGAGTTTATTCAGATGTCTGTTCA
AAGAATTGTGGAAGATGCACCACCGATTGACCTACAGGCCGAAGCTCAGCACGCCAGTGGAGAAGTTGAA
GAGCCGCCAAGATATTTACTGAAGTTTGAACAAATTTACCTCTCCAAACCTACTCATTGGGAAAGAGATG
GTGCCCCTTCGCCAATGATGCCAAATGAAGCCAGGTTAAGAAATCTCACGTATTCTGCTCCGCTTTACGT
TGACATAACAAAGACAGTCATTAAAGAAGGTGAAGAACAGCTGCAGACTCAGCACCAGAAAACGTTCATA
GGGAAAATTCCAATTATGCTGCGCTCCACCTACTGCCTGTTAAATGGCTTAACAGATCGTGACCTGTGTG
AGCTGAATGAGTGTCCTTTGGATCCCGGTGGCTATTTTATTATCAATGGATCAGAAAAGGTTCTGATAGC
TCAAGAGAAAATGGCAACAAACACAGTCTATGTGTTTGCCAAAAAGGATTCCAAGTATGCCTATACAGGA
GAATGTCGCTCATGCCTGGAGAATTCTTCCCGACCCACCAGTACTATATGGGTTAGCATGCTGGCCAGAG
GAGGACAGGGTGCAAAGAAGAGTGCTATTGGCCAGCGCATCGTGGCAACGTTACCATACATCAAGCAAGA
AGTTCCTATCATCATTGTGTTCAGAGCACTAGGCTTTGTGTCTGATAGAGATATTTTAGAACACATCATT
TATGACTTCGAGGATCCAGAGATGATGGAAATGGTTAAACCATCTCTCGATGAAGCGT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GCTTTGCGATTCCGAGTAAG; Reverse Primer - name:unspecified, sequence:ACGCTTCATCGAGAGATGGT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13755 same embryo
 EMAGE:13754 same embryo
 EMAGE:13753 same embryo
 EurExpress:euxassay_019551 same experiment
 MGI:4827318 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS