Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:138

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:138
Fig 5D, Crossley & Martin, 1995 [PMID:7768185] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Abbreviations used in this figure: zl - zona limitans, cp - commisural plate, inf - infundibulum, is - isthmus
Expression Pattern Description
Spatial Annotation:
EMAGE:138EMAGE:138Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
138_voxel_strong_3D_1.wlz
138_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:138_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
future midbrain floor plate
detected detected
regionalExpression is in a sharp-narrow band in the region of the midbrain-hindbrain junction (isthmus). This does not include cells of the ventral midline. Expression is immediately caudal to Wnt1 expression
future midbrain lateral wall
detected detected
regionalExpression is in a sharp-narrow band in the region of the midbrain-hindbrain junction (isthmus). This does not include cells of the ventral midline. Expression is immediately caudal to Wnt1 expression
future midbrain roof plate
detected detected
regionalExpression is in a sharp-narrow band in the region of the midbrain-hindbrain junction (isthmus). This does not include cells of the ventral midline. Expression is immediately caudal to Wnt1 expression
future hindbrain
detected detected
regionalExpression is in a sharp-narrow band in the region of the midbrain-hindbrain junction (isthmus). This does not include cells of the ventral midline. Expression is immediately caudal to Wnt1 expression
telencephalon floor plate
detected detected
regionalExpression is in the commisural plate
telencephalon lateral wall
detected detected
regionalExpression is in the commisural plate
telencephalon roof plate
detected detected
regionalExpression is in the commisural plate
diencephalon gland
detected detected
regionalExpression is in the infundibular region of the hypothalamus
future neurohypophysis
detected detected
regionalExpression is in the posterior pituitary with a sharp caudal boundary at the mammillary area.
future forebrain
detected detected
regionalExpression is in the alar plate of the ventral thalamus and extends lateral to the dorsal midline just rostral to the zona limitans.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:Probe used in this study by Crossley & Martin, 1995 [PMID:7768185] is described as a "400nt cDNA probe containing the 3'UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al, 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:Swiss Webster
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:section
Procedures
Staining procedure:autoradiography
General Information
Authors:Crossley & Martin, 1995 [PMID:7768185] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:1335641 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI