Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13821

Ctcfl CCCTC-binding factor (zinc finger protein)-like ( MGI:3652571)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821
"Pseudo-wholemount" of euxassay_019660. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019660_01 euxassay_019660_02 euxassay_019660_03 euxassay_019660_04
EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821
euxassay_019660_05 euxassay_019660_06 euxassay_019660_07 euxassay_019660_08 euxassay_019660_09
EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821
euxassay_019660_10 euxassay_019660_11 euxassay_019660_12 euxassay_019660_13 euxassay_019660_14
EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821 EMAGE:13821
euxassay_019660_15 euxassay_019660_16 euxassay_019660_17 euxassay_019660_18 euxassay_019660_19
EMAGE:13821 EMAGE:13821 EMAGE:13821
euxassay_019660_20 euxassay_019660_21 euxassay_019660_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13821Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13821_wholemount_strong.wlz
13821_wholemount_moderate.wlz
13821_wholemount_weak.wlz
13821_wholemount_possible.wlz
13821_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13821_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 19 weak expression: see section 04 05 06 07 08 20 22
pons mantle layer
moderate moderate
single cellmoderate expression: see section 08 10 11 14 15 16 17
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 06
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 07 19 weak expression: see section 18
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 17 19 20 weak expression: see section 18
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 08 weak expression: see section 17
ventral grey horn
moderate moderate
single cellmoderate expression: see section 13 14 16 weak expression: see section 10 11 15
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 13 15 16 17 18 weak expression: see section 07 08 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55029
Entity Detected:Ctcfl, CCCTC-binding factor (zinc finger protein)-like ( MGI:3652571)
Sequence:sense strand is shown

>T55029
GCTACCACGATGCTTTCAATGAATTCTAAAGTCAACCTGAGAATCTTAATGCTGCGGAAAGATGAATTGG
TAGAAACAATGCTCATTTAACTAGAAAAAAAATATATATATATCATAGCTCTTTCTTTGGCATAGAGCAA
GGCTCACCTTTAGTTTTTGCCCCTCCTCCCCCATCTTGTAGGCCTATGGGTTAAACCCAGGGCTTGGCAC
AATTTAGACAAGTGCCCCACCACCAGGCCATACCCCCAGCCCCCACACAACTTCCAAAAAAAATTAAATT
ATCCAGGCTGGATTTGAACTCAATTTGGAGTCCAGCTGCACTTCAAACTGTCCATTCTCCTGCCTCCGTC
TTGCAGGAATGACGAGCCTTTACCACCAGGCCGGGCTTGTCTTCTCTTAATTGTAGTCTTCGCCCGCTAT
GAAATTACACTGGCATTGTTGCAAGCATTGGCTTTGTTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GCTACCACGATGCTTTCAATG; Reverse Primer - name:unspecified, sequence:GAACAAAGCCAATGCTTGC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13822 same embryo
 EMAGE:13823 same embryo
 EMAGE:13820 same embryo
 EurExpress:euxassay_019660 same experiment
 MGI:4824099 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS