Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13871

Mir466g microRNA 466g ( MGI:3718536)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871
"Pseudo-wholemount" of euxassay_019269. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019269_01 euxassay_019269_02 euxassay_019269_03 euxassay_019269_04
EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871
euxassay_019269_05 euxassay_019269_06 euxassay_019269_07 euxassay_019269_08 euxassay_019269_09
EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871
euxassay_019269_10 euxassay_019269_11 euxassay_019269_12 euxassay_019269_13 euxassay_019269_14
EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871 EMAGE:13871
euxassay_019269_15 euxassay_019269_16 euxassay_019269_17 euxassay_019269_18 euxassay_019269_19
EMAGE:13871 EMAGE:13871 EMAGE:13871
euxassay_019269_20 euxassay_019269_21 euxassay_019269_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13871Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13871_wholemount_strong.wlz
13871_wholemount_moderate.wlz
13871_wholemount_weak.wlz
13871_wholemount_possible.wlz
13871_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13871_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 13 14 15 16 17 moderate expression: see section 10 11 12
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 12 13 14 15 16 17 18 19 20 21 22 moderate expression: see section 09 10 11
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 07 08 09 14 15 16 17 moderate expression: see section 10 11
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 13 14 15 16 moderate expression: see section 10 11 12
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 09
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 14 15 16 17 18 19 20 moderate expression: see section 09
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 08 12 13 14 15 16 17 moderate expression: see section 09 10
pons marginal layer
moderate moderate
regionalmoderate expression: see section 11
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 12 13 14 15 16 17 18 moderate expression: see section 09 10 11
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 19 20
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
vagus x ganglion
strong strong
regionalstrong expression: see section 09
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 17
spinal cord mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70045
Entity Detected:Mir466g, microRNA 466g ( MGI:3718536)
Sequence:sense strand is shown

>T70045
ATACAGACACATGCACACACA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-466g was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13870 same embryo
 EurExpress:euxassay_019269 same experiment
 MGI:4826310 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS