Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13872

Sp5 trans-acting transcription factor 5 ( MGI:1927715)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872
"Pseudo-wholemount" of euxassay_019631. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019631_01 euxassay_019631_02 euxassay_019631_03 euxassay_019631_04
EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872
euxassay_019631_05 euxassay_019631_06 euxassay_019631_07 euxassay_019631_08 euxassay_019631_09
EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872
euxassay_019631_10 euxassay_019631_11 euxassay_019631_12 euxassay_019631_13 euxassay_019631_14
EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872 EMAGE:13872
euxassay_019631_15 euxassay_019631_16 euxassay_019631_17 euxassay_019631_18 euxassay_019631_19
EMAGE:13872 EMAGE:13872 EMAGE:13872
euxassay_019631_20 euxassay_019631_21 euxassay_019631_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13872Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13872_wholemount_strong.wlz
13872_wholemount_moderate.wlz
13872_wholemount_weak.wlz
13872_wholemount_possible.wlz
13872_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13872_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 09 10 11
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 09 10 11
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 19 weak expression: see section 09 15 16 17 18
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 11 13 15 16 17 19 20 weak expression: see section 10 14 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 13 14 15 16 17
midbrain ventricular layer
weak weak
regionalweak expression: see section 11 12
cochlea
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 04 05 06 07
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 10 14
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 17 weak expression: see section 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 10 11 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 18
lung
weak weak
regionalweak expression: see section 04 05 06 07 08 09 11 12 13 15 16 17 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55188
Entity Detected:Sp5, trans-acting transcription factor 5 ( MGI:1927715)
Sequence:sense strand is shown

>T55188
AGAAGCTCAAAGTCGCTGAGGCCGGGGTGAAGCGGGAGAATCCGCGGGACCTATGAGCGCACCGGGACAC
TTTCGAGGCCACTCCTGCCCAAGACATCTTTCCCAGCACCTTTGCTGGCACACCAGGGTACTTGCCATCG
AGGTAGCTGACAAAGAGTAACTTTTTAAATGAACTTTTTATTCTCCTCCGCCCGAAGTCTTGCTGTCCAG
CCCAAGAGCAGAGGGCAGGGCAGGCAGGACAGGAAACTGGGTCGTAGTTGAGTTACCCCAGGAGGATTCC
AAAGTCCGAGCCATCGCCTGCCTGGGAGACTTACATTTTACCCAGGGCTGGCCTTGCTTGTGGGAGTCGC
TGCTGAAAAAAAATTTTAAAAAGAAGGCTCTTGGGAGATTTAAAAACAAGGCCTAAGTTTTTGCTAGGCC
CGATTCGGACTTTGTACAGGTTATTTAATAATAGCTTTGTTAAAGAGTAATTATGATTATAACGTTAATA
AATGTTTCTGTTGTTCTCAGCTCCACGCAGAGCTACAGCATGGTACGTTTCTGTAAAGCGAACAGCAGTT
GGCAGCGTGAAAATAAATACTTCATTCCAGGGTCTCCTCG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGAAGCTCAAAGTCGCTGAGG; Reverse Primer - name:unspecified, sequence:CGAGGAGACCCTGGAATGA. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828396 same experiment
 EurExpress:euxassay_019631 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS