Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13896

A130022J15Rik RIKEN cDNA A130022J15 gene ( MGI:2141669)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896
"Pseudo-wholemount" of euxassay_007775. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007775_01 euxassay_007775_02 euxassay_007775_03 euxassay_007775_04
EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896
euxassay_007775_05 euxassay_007775_06 euxassay_007775_07 euxassay_007775_08 euxassay_007775_09
EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896
euxassay_007775_10 euxassay_007775_11 euxassay_007775_12 euxassay_007775_13 euxassay_007775_14
EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896 EMAGE:13896
euxassay_007775_15 euxassay_007775_16 euxassay_007775_17 euxassay_007775_18 euxassay_007775_19
EMAGE:13896
euxassay_007775_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13896Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13896_wholemount_strong.wlz
13896_wholemount_moderate.wlz
13896_wholemount_weak.wlz
13896_wholemount_possible.wlz
13896_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13896_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 20
diencephalon lateral wall mantle layer
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14
diencephalon meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
telencephalon mantle layer
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata alar plate mantle layer
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
medulla oblongata basal plate mantle layer
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
hindbrain meninges
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
pons mantle layer
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
midbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14
midbrain mantle layer
strong strong
spottedstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14
spinal cord mantle layer
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 12
spinal cord meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12
aorta
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 08 10 11 12
left lung
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
right lung
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2602
Entity Detected:A130022J15Rik, RIKEN cDNA A130022J15 gene ( MGI:2141669)
Sequence:sense strand is shown

>T2602
TGGCCTCGAGGCCAGATTCGGCACGAGGATGCACTGAAAACAGTATCCACATTTGAAGTCCGGGTGGTTG
ATTACAAGTACAGAGAACTCGGGTTTTTAGATCAGCTCAGGATCACGCACAACACGGACATATTTATTGG
CATGCATGGAGCTGGCCTTACCCACTTACTTTTCCTTCCGGACTGGGCTGCTGTGTTCGAGCTGTACAAC
TGTGAAGATGAGCGCTGCTACTTAGACCTGGCCAGGCTCAGAGGCATCCACTACATCACCTGGCGGAAGC
CCAGCAAAGTATTTCCTCAGGATAAGGGTCACCATCCAACTCTGGGAGAACACCCGAAGTTTACCAACTA
CTCTTTTGATGTAGAAGAATTCATGTACCTTGTCCTTCAGGCTGCAGAGCATGTACTGCAGCACCCACAG
TGGCCATTTAAGAAGAAACATGATGAGCTATAGAAGTGTTGAGGTTGTTTCCAAGAGTGTTGACACCCTC
TCACAGCCATAGACTCACAATCAGAGGAGCAGAACAGCCTGTCATATCCTACTGTAAGAGGAAACATG
Notes:The probe template was PCR amplified from IMAGE:1384167 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1384167 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4822818 same experiment
 EurExpress:euxassay_007775 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS