Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13910

Hmg20a high mobility group 20A ( MGI:1914117)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910
"Pseudo-wholemount" of euxassay_007766. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007766_01 euxassay_007766_02 euxassay_007766_03 euxassay_007766_04
EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910
euxassay_007766_05 euxassay_007766_06 euxassay_007766_07 euxassay_007766_08 euxassay_007766_09
EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910
euxassay_007766_10 euxassay_007766_11 euxassay_007766_12 euxassay_007766_13 euxassay_007766_14
EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910 EMAGE:13910
euxassay_007766_15 euxassay_007766_16 euxassay_007766_17 euxassay_007766_18 euxassay_007766_19
EMAGE:13910 EMAGE:13910 EMAGE:13910
euxassay_007766_20 euxassay_007766_21 euxassay_007766_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13910Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13910_wholemount_strong.wlz
13910_wholemount_moderate.wlz
13910_wholemount_weak.wlz
13910_wholemount_possible.wlz
13910_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13910_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
adrenal medulla
strong strong
regionalstrong expression: see section 08 09 10 14 15 16
thyroid gland
strong strong
regionalstrong expression: see section 10 11 14 15
brain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 16 moderate expression: see section 07 08 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 16
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 11 14
cervical ganglion
strong strong
regionalstrong expression: see section 08 09 16
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 22
heart ventricle
strong strong
regionalstrong expression: see section 08 16 17 moderate expression: see section 09 10 11 12 13 14 15
stomach
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11
midgut
strong strong
spottedstrong expression: see section 12 13 14 15 16 17 18 19 20
testis
strong strong
regionalstrong expression: see section 05 06 07 08 17 18 19
axial skeleton
strong strong
regionalstrong expression: see section 12
axial skeleton tail region
strong strong
regionalstrong expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1346
Entity Detected:Hmg20a, high mobility group 20A ( MGI:1914117)
Sequence:sense strand is shown

>T1346
TCCTCNAGACTGTTGGCCTACTGGAAAGAGTGAAGGCGATTGCGAGGGGCTGAGGGAATTGTCCTCTGTG
CAAGGGACTTTCATTAGTCCCCAGGCCCCTGCCTGCTCCTGCCGTCAGCAGGGAGATGGAGAGCTTGATG
GCCAGTTCTACCCTGCCGCCCCTGTTTGCAGATGAAGATGGCTCCAAGGAGAGCAATGATCTGGCTACAT
CTGGGTTAACACACCCCGAGGGTCCGTATGGCAGTGCAGCCACATCAACAACCAACCCAGAGTTTGTGGA
GGATCTCTCCCAAGGCCAGCTGCTTCAGAGTGAGGCTTCCAATGCTGTAGAAGGCAATGAGCAAAGGCCT
GAAGATGAGCAAAGAAGTAAACGAGGAGGTTGGTCCAAAGGGAGAAAAAGGAAGAAACCTCTTCGAGACA
GCAATGCACCTAAATCCCCCCTTACAGGATATGTTCGATTCATGAACGAGCGTAGAGAACAGCTTCGAGC
AAAGAGACCAGAGGTTCCATTTCCAGAAATCACAAGGATGTTGGGCAATGAGTGGAGTAAACTGCCTCCT
GAGGAAAAGCAGCGCTACCTT
Notes:The probe template was PCR amplified from IMAGE:2300867 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2300867 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13908 same embryo
 EMAGE:13909 same embryo
 EMAGE:13907 same embryo
 EMAGE:13904 same embryo
 EMAGE:13905 same embryo
 EMAGE:13906 same embryo
 EurExpress:euxassay_007766 same experiment
 MGI:4825387 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS