Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13924

Hmox1 heme oxygenase (decycling) 1 ( MGI:96163)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924
"Pseudo-wholemount" of euxassay_007745. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007745_01 euxassay_007745_02 euxassay_007745_03 euxassay_007745_04
EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924
euxassay_007745_05 euxassay_007745_06 euxassay_007745_07 euxassay_007745_08 euxassay_007745_09
EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924
euxassay_007745_10 euxassay_007745_11 euxassay_007745_12 euxassay_007745_13 euxassay_007745_14
EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924 EMAGE:13924
euxassay_007745_15 euxassay_007745_16 euxassay_007745_17 euxassay_007745_18 euxassay_007745_19
EMAGE:13924 EMAGE:13924
euxassay_007745_20 euxassay_007745_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13924Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13924_wholemount_strong.wlz
13924_wholemount_moderate.wlz
13924_wholemount_weak.wlz
13924_wholemount_possible.wlz
13924_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13924_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
brain
strong strong
single cellstrong expression: see section 01 02 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21
diencephalon meninges
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
hindbrain meninges
strong strong
spottedstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19
midbrain meninges
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
central nervous system ganglion
strong strong
single cellstrong expression: see section 07
spinal cord
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 13 14
spinal cord meninges
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2625
Entity Detected:Hmox1, heme oxygenase (decycling) 1 ( MGI:96163)
Sequence:sense strand is shown

>T2625
TGGCCTCGAGCCAGATTCGGACGAGGGTTTCCGCATACAACCAGTGAGTGGAGCCTGCCCGCGCAGAGCC
GTCTCGAGCATAGCCCGGAGCCTGAATCGAGCAGAACCAGCCTGAACTAGCCCAGTCCGGTGATGGAGCG
TCCACAGCCCGACAGCATGCCCCAGGATTTGTCTGAGGCCTTGAAGGAGGCCACCAAGGAGGTACACATC
CAAGCCGAGAATGCTGAGTTCATGAAGAACTTTCAGAAGGGTCAGGTGTCCAGAGAAGGCTTTAAGCTGG
TGATGGCTTCCTTGTACCATATCTACACGGCCCTGGAAGAGGAGATAGAGCGCAACAAGCAGAACCCAGT
CTATGCCCCACTCTACTTCCCTGAGGAGCTGCACCGAAGGGCTGCCCTGGAGCAGGACATGGCCTTCTGG
TATGGGCCTCACTGGCAGGAAATCATCCCTTGCACGCCAGCCACACAGCACTATGTAAAGCGTCTCCACG
AGGTGGGGCGCACTCACCCTGAGCTGCTGGTGGCCCACGCATATACCCGCTACCTGG
Notes:The probe template was PCR amplified from IMAGE:1400738 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1400738 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13923 same embryo
 EMAGE:13922 same embryo
 EMAGE:13920 same embryo
 EMAGE:13921 same embryo
 EurExpress:euxassay_007745 same experiment
 MGI:4825397 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS