Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13927

Tfb2m transcription factor B2, mitochondrial ( MGI:107937)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927
"Pseudo-wholemount" of euxassay_007769. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007769_01 euxassay_007769_02 euxassay_007769_03 euxassay_007769_04
EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927
euxassay_007769_05 euxassay_007769_06 euxassay_007769_07 euxassay_007769_08 euxassay_007769_09
EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927
euxassay_007769_10 euxassay_007769_11 euxassay_007769_12 euxassay_007769_13 euxassay_007769_14
EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927 EMAGE:13927
euxassay_007769_15 euxassay_007769_16 euxassay_007769_17 euxassay_007769_18 euxassay_007769_19
EMAGE:13927
euxassay_007769_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13927Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13927_wholemount_strong.wlz
13927_wholemount_moderate.wlz
13927_wholemount_weak.wlz
13927_wholemount_possible.wlz
13927_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13927_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
limb
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
mesenchyme
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
vertebral axis musculature
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
gland
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
alimentary system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
integumental system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 13 14 15 16 17 18 19
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12
sensory organ system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
cardiovascular system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
urinary system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
reproductive system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
respiratory system
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 16 17 18 19 20
tail
moderate moderate
othermoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1384
Entity Detected:Tfb2m, transcription factor B2, mitochondrial ( MGI:107937)
Sequence:sense strand is shown

>T1384
TCCTCGAGCCTGTTGGCCTACTGGGTAATGTTTACTTCCGCCCGGCCTAGTGTGGTGGTGAAATGTGTGC
ACGTGTGATGGGGTGCTCTGCGTTCTTCGCAGAGGCTACCTTAACTGGTGTTTGAGGTGGACTTTAGAGG
AGGATGAGGGGACCGGCGATGCGGCTTCCCCCGCGGATCGCGCTGTCAGCGTTGGCCCGCGGCCCATCTT
GCATTCTAGGGTCCGGAGCGGCGACGCGGAAGGACTGGCAAACGAGGAACCGCCGCGGCTTCTCTGACTT
CAATATAGAGCCGTTGCCTGATTCTGATTTGGAGGAGTCGTCCCCGTGGACATCCAGGAATCGATCGGAG
CCTACGCGTCACATAGCATGTAAGAAAGCGGCCAGGAACCTGGTACGGGACCTGCTGGAGCACCAAAACT
CATCCCGTCAAATTATACTAGAGTGCAATCCAGGTCCTGGAATCCTGACTGGGGCATTACTTAAAGCTGG
TGCCAGAGTGGTTGCCTTTGAAAGTGAAAAGACTTTTATTCCACATTTGGAGCCCTTACAGAGGAACATG
GATGGAGAGCTACAGGTGGTTCA
Notes:The probe template was PCR amplified from IMAGE:2332288 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2332288 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13926 same embryo
 EMAGE:13928 same embryo
 EMAGE:13925 same embryo
 EurExpress:euxassay_007769 same experiment
 MGI:4828671 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS