Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13935

St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 ( MGI:106018)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935
"Pseudo-wholemount" of euxassay_007776. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007776_01 euxassay_007776_02 euxassay_007776_03 euxassay_007776_04
EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935
euxassay_007776_05 euxassay_007776_06 euxassay_007776_07 euxassay_007776_08 euxassay_007776_09
EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935
euxassay_007776_10 euxassay_007776_11 euxassay_007776_12 euxassay_007776_13 euxassay_007776_14
EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935 EMAGE:13935
euxassay_007776_15 euxassay_007776_16 euxassay_007776_17 euxassay_007776_18 euxassay_007776_19
EMAGE:13935
euxassay_007776_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13935Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13935_wholemount_strong.wlz
13935_wholemount_moderate.wlz
13935_wholemount_weak.wlz
13935_wholemount_possible.wlz
13935_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13935_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19 20
organ system
moderate moderate
regionalmoderate expression: see section 10
brain
moderate moderate
spottedmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
trigeminal v ganglion
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 16 17 18
spinal cord
moderate moderate
spottedmoderate expression: see section 10 11 12 13 14 15 16 17
dorsal root ganglion
moderate moderate
spottedmoderate expression: see section 07 08 10 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 17 18 19
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 11 12 13 14 15
left lung
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
spottedmoderate expression: see section 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2585
Entity Detected:St8sia4, ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 ( MGI:106018)
Sequence:sense strand is shown

>T2585
CTTTTTCTAATGTTTTAATCATGCACTTGGGAATACCCAGGTAGCTGACTGTGAAATATCCCAGTCACTG
AGCTAACATGATTGCTACTGTGCTTTTGACATGAACAGACCATGGAAATATTTTCATCATTGCTACTCAG
CATAAACTATACTTAATAAAAAGTTGTTGAAAGAAAACATGAATCAATAATAGATTTTCAGAGCAAATCT
AGTGATTCAGCCCACAGGACCAATGAAAGTACTGTGGAAGCTTTCCTCACTTAGAGAAGGTGCTGGGCAT
TCAAATGTCTTCATGTGTTGTATTTCATATGAGCTGTATATCAATTGTTAATGAAAATCTCCACATATAT
CCTTACAGAAATGCTTTATTCAAGAAATGCTAAGGGTAGTGTACAGACAAGTGATTTACTCAGTTACTAT
TCAAGAAAGGGTAAGCAAAGTAATTTATTTATAGTTGTGCCAGTTAGTCATAATACATATTATGTGATAT
TTGGTTCACAGAGTTGTTTTCATGTGATTATTATGAG
Notes:The probe template was PCR amplified from IMAGE:1383424 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383424 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13936 same embryo
 EMAGE:13934 same embryo
 EurExpress:euxassay_007776 same experiment
 MGI:4828470 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS