Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13944

Psph phosphoserine phosphatase ( MGI:97788)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944
"Pseudo-wholemount" of euxassay_007810. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007810_01 euxassay_007810_02 euxassay_007810_03 euxassay_007810_04
EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944
euxassay_007810_05 euxassay_007810_06 euxassay_007810_07 euxassay_007810_08 euxassay_007810_09
EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944
euxassay_007810_10 euxassay_007810_11 euxassay_007810_12 euxassay_007810_13 euxassay_007810_14
EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944 EMAGE:13944
euxassay_007810_15 euxassay_007810_16 euxassay_007810_17 euxassay_007810_18 euxassay_007810_19
EMAGE:13944 EMAGE:13944 EMAGE:13944
euxassay_007810_20 euxassay_007810_21 euxassay_007810_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13944Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13944_wholemount_strong.wlz
13944_wholemount_moderate.wlz
13944_wholemount_weak.wlz
13944_wholemount_possible.wlz
13944_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13944_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 08 09 10 11 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 05 06 14 15 moderate expression: see section 07 08 13 16
vibrissa
weak weak
regionalweak expression: see section 03 04 05 06 19 20
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 11 15 16 17
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 weak expression: see section 02 03 04
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 10 11 12 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 weak expression: see section 10 11 12 13 14 15 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 weak expression: see section 10 11 12 13 14 15
liver left lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11
liver right lobe
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20
kidney calyx
moderate moderate
regionalmoderate expression: see section 05 06 07 08 13 14 15 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3094
Entity Detected:Psph, phosphoserine phosphatase ( MGI:97788)
Sequence:sense strand is shown

>T3094
TGGCCTCGAGNCAGATTCGGCACGAGGCTTCCCAGGATGGTCTCCCACTCAGAGCTGAGGAAGCTCTTCT
GTTCAGCGGATGCAGTGTGCTTTGATGTTGATAGCACCGTCATCAGAGAAGAAGGAATCGATGAGCTGGC
CAAATTCTGTGGTGTGGAGGCCGCAGTGTCTGAAATGACACGGAGAGCCATGGGAGGAGCATTGCCTTTT
AAAGACGCGCTCACTCAGCGCCTGGCACTGATCCAGCCCTCCAGGGATCAAGTCCAGAGGCTCCTAGCTG
AGCACCCGCCACATCTGACTCCTGGCATAAGGGAGCTGGTAAGCCGCCTCCAGGAGCGTAATGTCCAGGT
GTTCCTCATCTCTGGTGGCTTTCGGAGCATTGTGGAGCACGTTGCTGCAAAGCTCAATATCCCAACAACC
AATGTGTTTGCCAATAGGCTGAAGTTCTACTTTAATGGTGAGTACGCAGGTTTTGATGAGATGCAGCCGA
CAGCCGAGTCGGGTGGGAAAGGAAAGGTTATTCGGTTTTTAAAGGAAAAATTTCACTTTAAGAAAAT
Notes:The probe template was PCR amplified from IMAGE:1547021 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547021 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13941 same embryo
 EMAGE:13943 same embryo
 EMAGE:13942 same embryo
 EurExpress:euxassay_007810 same experiment
 MGI:4827495 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS