Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13955

Mtch1 mitochondrial carrier homolog 1 (C. elegans) ( MGI:1929261)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955
"Pseudo-wholemount" of euxassay_007787. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007787_01 euxassay_007787_02 euxassay_007787_03 euxassay_007787_04
EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955
euxassay_007787_05 euxassay_007787_06 euxassay_007787_07 euxassay_007787_08 euxassay_007787_09
EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955
euxassay_007787_10 euxassay_007787_11 euxassay_007787_12 euxassay_007787_13 euxassay_007787_14
EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955 EMAGE:13955
euxassay_007787_15 euxassay_007787_16 euxassay_007787_17 euxassay_007787_18 euxassay_007787_19
EMAGE:13955 EMAGE:13955 EMAGE:13955
euxassay_007787_20 euxassay_007787_21 euxassay_007787_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13955Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13955_wholemount_strong.wlz
13955_wholemount_moderate.wlz
13955_wholemount_weak.wlz
13955_wholemount_possible.wlz
13955_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13955_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thyroid gland
strong strong
regionalstrong expression: see section 10 11 12 13 14
diencephalon roof plate
strong strong
regionalstrong expression: see section 12 13
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 07 08 09 10 11 13 14 15 16 17 18
choroid invagination
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2578
Entity Detected:Mtch1, mitochondrial carrier homolog 1 (C. elegans) ( MGI:1929261)
Sequence:sense strand is shown

>T2578
TGGCCTCGAGCAGATTCGGACGAGGCAGATGCCCAAGGGTGACTCCAGCCCAGCCTGGCTTCATGTCCAT
ATTTGCCATGTGTCTGTCCAGATGTGGGCTGGTGGAGGTGGGTCACCTGGGACCTGGGGAAGCCTGGGGG
AGCAGTGTTGGAGCGGCATCCCCTTCCTGCCTAGAGGTACTGGAGTCCATCTTGTACTCAGGCAGAGGCA
GGCTGCAGAGGCAAACGTCACTCAGTGGCAAGGCTTCCCTGCACCTCTAGCCCAGCTCATCCTGCCAGTC
AGCCAGAAGCACCCCCGCCCCCCACTTCCTGCTTTGTAAATTGGGCGCCATCACACCTGGGCCATGGGAG
GCTGGAGCTATGTTCCCAACACTAATTTTCTTATACAAGGGTGGTGCCTTCTCCTGAATAGGAAATCATG
TTCTCCTCAGACCATCCCCTCATCTGCTTGTCTGTGCTGGTGACGCCAGGTGTGAGGGTTCAGTCACTGT
GCTGGGTGCGAATACGCACAGGTTACATAGGCCGACATCTAGTCCTCCCCTCGTG
Notes:The probe template was PCR amplified from IMAGE:1383218 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383218 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13954 same embryo
 EMAGE:13953 same embryo
 EurExpress:euxassay_007787 same experiment
 MGI:4826488 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS