Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13957

Cidea cell death-inducing DNA fragmentation factor, alpha subunit-like effector A ( MGI:1270845)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957
"Pseudo-wholemount" of euxassay_007794. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007794_01 euxassay_007794_02 euxassay_007794_03 euxassay_007794_04
EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957
euxassay_007794_05 euxassay_007794_06 euxassay_007794_07 euxassay_007794_08 euxassay_007794_09
EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957
euxassay_007794_10 euxassay_007794_11 euxassay_007794_12 euxassay_007794_13 euxassay_007794_14
EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957 EMAGE:13957
euxassay_007794_15 euxassay_007794_16 euxassay_007794_17 euxassay_007794_18 euxassay_007794_19
EMAGE:13957 EMAGE:13957 EMAGE:13957
euxassay_007794_20 euxassay_007794_21 euxassay_007794_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13957Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13957_wholemount_strong.wlz
13957_wholemount_moderate.wlz
13957_wholemount_weak.wlz
13957_wholemount_possible.wlz
13957_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13957_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3074
Entity Detected:Cidea, cell death-inducing DNA fragmentation factor, alpha subunit-like effector A ( MGI:1270845)
Sequence:sense strand is shown

>T3074
TGGCCTCGAGGCCAGATTCGGCACGAGGCTGAGGTTTATGTCCTATGCTGCACAGATGACGGGACAGTTC
CTGGTCTATGCGGGCACATACATGCTCCGAGTACTGGGCGATACAGAAGAGCAGCCATCCCCCAAGCCTA
GCACCAAAGGCTGGTTCATGTAACCAGGGCACAGCTACAGAGGCCCAGGGACCCTGCTCTCTGTTATAGG
CTGTGGGATGCCAGGGGAAGGAATGGGGGCTTGGGGGTGGTACCCAGTGCAGGGCTGAGTAGCAGGATTC
CTGCAAAGGAAAGGCGGCAGAGGGGCCTTTCAAGCGCTTTAGGAAGGGATCAACAGCGGAGTGTGTGGGA
ACTGCGTGGATACGAATCAGTTTCTTTGGATCCTTACATACTGTAATAAACCAGTCACATGAAAAAAAAA
AAAAAA
Notes:The probe template was PCR amplified from IMAGE:1546760 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1546760 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13959 same embryo
 EMAGE:13956 same embryo
 EMAGE:13958 same embryo
 EMAGE:13961 same embryo
 EMAGE:13960 same embryo
 EurExpress:euxassay_007794 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS