Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13971

Serpine2 serine (or cysteine) peptidase inhibitor, clade E, member 2 ( MGI:101780)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971
"Pseudo-wholemount" of euxassay_007870. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007870_01 euxassay_007870_02 euxassay_007870_03 euxassay_007870_04
EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971
euxassay_007870_05 euxassay_007870_06 euxassay_007870_07 euxassay_007870_08 euxassay_007870_09
EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971
euxassay_007870_10 euxassay_007870_11 euxassay_007870_12 euxassay_007870_13 euxassay_007870_14
EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971 EMAGE:13971
euxassay_007870_15 euxassay_007870_16 euxassay_007870_17 euxassay_007870_18 euxassay_007870_19
EMAGE:13971 EMAGE:13971 EMAGE:13971
euxassay_007870_20 euxassay_007870_21 euxassay_007870_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13971Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13971_wholemount_strong.wlz
13971_wholemount_moderate.wlz
13971_wholemount_weak.wlz
13971_wholemount_possible.wlz
13971_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13971_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 05 17 18 19
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05 17 18 19
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 03 19
hand mesenchyme
strong strong
regionalstrong expression: see section 02
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 01 20
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 19 20
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 01 19 20
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 19 20
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 01 19 20
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 19 20
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 01 19 20
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 01 19 20
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 01 19 20
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 01 19 20
foot mesenchyme
strong strong
regionalstrong expression: see section 02
thymus primordium
moderate moderate
regionalmoderate expression: see section 09 10 12 13
vibrissa
strong strong
regionalstrong expression: see section 04 05 18 19 moderate expression: see section 03 weak expression: see section 20
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 09 10 12 13 14 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 07 08 10 11 12 13 14 15
diencephalon lateral wall marginal layer
strong strong
single cellstrong expression: see section 09
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
telencephalon mantle layer
strong strong
single cellstrong expression: see section 02 03 04 05 06 07 08 09 11 13 15 17 18 19 20 21
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15
medulla oblongata alar plate mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 13 14 15 16
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 12
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 15 16 17 18 19
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 15
ventral grey horn
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 19 20 21 22
nasal septum
strong strong
regionalstrong expression: see section 10 11 12 13
viscerocranium
strong strong
regionalExpression in the turbinate bone.
lower lip
strong strong
regionalstrong expression: see section 06 07 08 09 12 14 moderate expression: see section 16 17
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 14 15 16 17 18 moderate expression: see section 03
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 12 13
upper lip
strong strong
regionalstrong expression: see section 06 07 08 09 12 14 15 moderate expression: see section 16 17
maxilla
strong strong
regionalstrong expression: see section 04 05 06 16 17 18 moderate expression: see section 03
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 13
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 11 12 13 14 15 16 17 18 19
axial skeleton
moderate moderate
regionalmoderate expression: see section 10 11 12 13
sternum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3104
Entity Detected:Serpine2, serine (or cysteine) peptidase inhibitor, clade E, member 2 ( MGI:101780)
Sequence:sense strand is shown

>T3104
CNAGCCAGAATTCGGACGAGGACAAAAATAACAAGGTCAGAGAGCCTTCATGTCTCTCACATCTTGCAAA
AAGCAAAAATTGAAGTCAGTGAAGATGGAACCAAAGCTTCGGCAGCAACAACTGCAATCCTAATTGCAAG
GTCATCACCTCCCTGGTTTATAGTAGACAGGCCTTTCCTGTTTTCCATCCGACACAATCCCACAGGTGCC
ATCTTGTTCCTGGGCCAGGTGAACAAGCCCTGAAGGACAGACAAAGGAAAGCCACGCAAAGCCAAGACGA
CTTGGCTCTGAAGAGAGACTCCCTCCCCACATCTTTCATAGTTCTGTTAAATATTTTTATATACTGCTTT
CTTTTTTGAAACTGGTTCATAGCAGCAGTTAAGTGACGCAAGTGTTTCTGGTCGGGGCTGTGTAGAAGAA
AGGGCTGGATGCCTGGGATGCTGGATGCCTGGGATGCTGGATGCCTGGGATGCTGGATGCCTGGGATGCT
GGATGCCTGGGATGCTGGATGCCTGGGATGCTGTAGTGAAGGATGAGCAGGCCGGTTTC
Notes:The probe template was PCR amplified from IMAGE:1547188 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547188 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13970 same embryo
 EMAGE:13969 same embryo
 EMAGE:13968 same embryo
 EMAGE:13972 same embryo
 EurExpress:euxassay_007870 same experiment
 MGI:4828000 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS