Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14044

Lsm5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) ( MGI:1913623)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044
"Pseudo-wholemount" of euxassay_001693. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001693_01 euxassay_001693_02 euxassay_001693_03 euxassay_001693_04
EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044
euxassay_001693_05 euxassay_001693_06 euxassay_001693_07 euxassay_001693_08 euxassay_001693_09
EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044
euxassay_001693_10 euxassay_001693_11 euxassay_001693_12 euxassay_001693_13 euxassay_001693_14
EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044
euxassay_001693_15 euxassay_001693_16 euxassay_001693_17 euxassay_001693_18 euxassay_001693_19
EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044 EMAGE:14044
euxassay_001693_20 euxassay_001693_21 euxassay_001693_22 euxassay_001693_23 euxassay_001693_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14044Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14044_wholemount_strong.wlz
14044_wholemount_moderate.wlz
14044_wholemount_weak.wlz
14044_wholemount_possible.wlz
14044_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14044_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12
esophagus
moderate moderate
regionalmoderate expression: see section 11
renal cortex
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3110
Entity Detected:Lsm5, LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) ( MGI:1913623)
Sequence:sense strand is shown

>T3110
AAAGAATTGTCGGGACACTTCTAGGATTTGATGACTTTGTCAATATGGTGTTGGAAGATGTCACAGAATT
TGAAATTACACCAGAAGGAAGAAGAATTACAAAATTAGATCAAATTCTACTAAATGGAAATAATATAACA
ATGCTGGTTCCCGGAGGAGAAGGGCCTGAAGTATGAATGGATTTCCTCGACGTTGTTTTCAAACCTTTAA
CATTTAGAGTCTATAAATGAAGTTTCCGTTAAAGGGAAACTCTTTGAAGATATACATCCATTTTTCTAAG
CTAATCATGGTTATTTTGGGAAAAGAAGAGTTTTGTTTTGTCTTCTTTTTTTTTTTTAAAGACTAAAAAA
AATAAAGATGTTTTTGGTTAACTGTNAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1547260 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1547260 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14046 same embryo
 EMAGE:14045 same embryo
 EMAGE:14048 same embryo
 EMAGE:14047 same embryo
 EMAGE:14043 same embryo
 EurExpress:euxassay_001693 same experiment
 MGI:4826013 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS