Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14060

Hoxa11 homeobox A11 ( MGI:96172)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060
"Pseudo-wholemount" of euxassay_001661. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001661_01 euxassay_001661_02 euxassay_001661_03 euxassay_001661_04
EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060
euxassay_001661_05 euxassay_001661_06 euxassay_001661_07 euxassay_001661_08 euxassay_001661_09
EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060
euxassay_001661_10 euxassay_001661_11 euxassay_001661_12 euxassay_001661_13 euxassay_001661_14
EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060 EMAGE:14060
euxassay_001661_15 euxassay_001661_16 euxassay_001661_17 euxassay_001661_18 euxassay_001661_19
EMAGE:14060 EMAGE:14060 EMAGE:14060
euxassay_001661_20 euxassay_001661_21 euxassay_001661_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14060Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14060_wholemount_strong.wlz
14060_wholemount_moderate.wlz
14060_wholemount_weak.wlz
14060_wholemount_possible.wlz
14060_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14060_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
elbow mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 20
knee mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 20
renal medullary interstitium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4021
Entity Detected:Hoxa11, homeobox A11 ( MGI:96172)
Sequence:sense strand is shown

>T4021
TGGCCTCGAGGCAGATTCGGCACGAGGGGTCTTCCATCTCAGAGCTGACTATTCCTAGGGTAGAAGACAT
TGAAAACTCCAGAGGCTGTGCTGGTTCCTGGCCCCTCAATCTCTACAGGAAATGCCTGCGGAGGGCTACA
GTTTGGCAAACTCTTCACCACATTAAGGAAACTTGGATTTGGTGTCTGTCAGGCAGCAGAGCAGCAGGCC
TGGCCAGTGGGTCCTTGGCCTTTGGCTGTGAGGGGCTGAAGTTCCCCCCCCCTCCCAAATCCCTCATTCC
TACCCTGCACTCTGTGCTCATCAATTCAGAACTGAGCTTGGAAGCTTCTGGCAATCTTCTAAGAGCCGGA
GAGTGATTTGGAGCTATTTTAAAAGATAAATATTATATTATATATATATATATTTCCCCGAAGGAACCAA
AGCGAATTTTAAGAAGCAATGTAGAGGGGGGGGGTGGGGATAATAAAAATATTTAAAGGCTCTATCTGTT
TACAGTGTTCCAAGGTTAAACTCGCTCACTGCTAAAATATTTGAATGTATGCTT
Notes:The probe template was PCR amplified from IMAGE:1450222 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1450222 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14061 same embryo
 EMAGE:14059 same embryo
 EMAGE:14062 same embryo
 EMAGE:14064 same embryo
 EMAGE:14063 same embryo
 EurExpress:euxassay_001661 same experiment
 MGI:4825413 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS