Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14067

Lum lumican ( MGI:109347)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067
"Pseudo-wholemount" of euxassay_001718. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001718_01 euxassay_001718_02 euxassay_001718_03 euxassay_001718_04
EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067
euxassay_001718_05 euxassay_001718_06 euxassay_001718_07 euxassay_001718_08 euxassay_001718_09
EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067
euxassay_001718_10 euxassay_001718_11 euxassay_001718_12 euxassay_001718_13 euxassay_001718_14
EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067 EMAGE:14067
euxassay_001718_15 euxassay_001718_16 euxassay_001718_17 euxassay_001718_18 euxassay_001718_19
EMAGE:14067 EMAGE:14067 EMAGE:14067
euxassay_001718_20 euxassay_001718_21 euxassay_001718_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14067Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14067_wholemount_strong.wlz
14067_wholemount_moderate.wlz
14067_wholemount_weak.wlz
14067_wholemount_possible.wlz
14067_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14067_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 15 16 17 18 19 20
diaphragm
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
dermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon meninges
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon meninges
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 21 22
hindbrain meninges
moderate moderate
homogeneousmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain meninges
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord meninges
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 12 13 14
cochlea
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 16 17 moderate expression: see section 18 19 20
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08
hindgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
bladder
strong strong
regionalstrong expression: see section 13
bladder
strong strong
regionalExpression in the fundus region.
clavicle
moderate moderate
homogeneousmoderate expression: see section 07 08 09 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2752
Entity Detected:Lum, lumican ( MGI:109347)
Sequence:sense strand is shown

>T2752
AGAGTATACCAACAGTTAATGAAAATCTTGAAAATTATTACCTGGAGGTCAATGAACTTGAAAAGTTTGA
TGTGAAGAGCTTCTGTAAGATCCTGGGACCACTGTCTTACTCCAAGATCAAGCATCTGCGCTTGGATGGC
AATCCTCTCACTCAGAGCAGTCTGCCTCCTGACATGTATGAGTGTCTACGTGTAGCAAATGAAATCACCG
TTAACTAACATCCTCTCATTCCAATACATTGAAGTATGTTCTGGAGCAGAACTTCATGGTTGGGAATGTG
GGGGATGTTTTAAAGTTTTCACAATATCCTTCTCGTTGCTGGTGGTATTACTTCATGGATTTTAATTAAT
GAAGGAAATGTTTTATGAACATTTACCACATTTAAATAAAAGATGAAAAGCAGGCCTTTTTCATCCTGAG
AACAGAAATACAAAACCCGTTAAACTTAAGTCTTTATTTGTAAATTTAATGTTTTCTACAGCTCTATGTT
CAGATGGTATGAAAGCCTTTTTACTGATTGCATGGAAATCAGCCAAGTTTTTTA
Notes:The probe template was PCR amplified from IMAGE:1514427 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1514427 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14066 same embryo
 EMAGE:14065 same embryo
 EMAGE:14068 same embryo
 EurExpress:euxassay_001718 same experiment
 MGI:4826023 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS