Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14076

Il17d interleukin 17D ( MGI:2446510)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076
"Pseudo-wholemount" of euxassay_001743. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001743_01 euxassay_001743_02 euxassay_001743_03 euxassay_001743_04
EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076
euxassay_001743_05 euxassay_001743_06 euxassay_001743_07 euxassay_001743_08 euxassay_001743_09
EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076
euxassay_001743_10 euxassay_001743_11 euxassay_001743_12 euxassay_001743_13 euxassay_001743_14
EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076
euxassay_001743_15 euxassay_001743_16 euxassay_001743_17 euxassay_001743_18 euxassay_001743_19
EMAGE:14076 EMAGE:14076 EMAGE:14076 EMAGE:14076
euxassay_001743_20 euxassay_001743_21 euxassay_001743_22 euxassay_001743_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14076Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14076_wholemount_strong.wlz
14076_wholemount_moderate.wlz
14076_wholemount_weak.wlz
14076_wholemount_possible.wlz
14076_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14076_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 11 12 13 14 15
brain
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 23
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 weak expression: see section 21
spinal cord
weak weak
homogeneousweak expression: see section 07 08 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 15 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17 18
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 11 12 13 14 15 16 17 18 19
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2577
Entity Detected:Il17d, interleukin 17D ( MGI:2446510)
Sequence:sense strand is shown

>T2577
TGGCCTCGAGGCCAGATTCGGCACGAGGTTTTTTTTTTTTTGAAGATAACACCAAAAACTTTAATCTTTA
TAAAGTTAAGACCATCCATAAGCTAAAGAACAAAGGGGCGCTTGGTTCCTAGCCCCCCCACATCCCTCCC
TCTCCAGGGACCTGGAGACCTTAGGTGCCCAGATCCGGAGCACTCATTATCACCTTAGTAAGCTTGGGCC
ACAGGAGAGACTCAGGGACAGGGCACAGTGCAGCAGAAGGAAGTTCATCTGAGCACTACAATTATGCACT
CAAGAATCCTACTAGAGGAAAACGGGATGTGTGTGATGTGCTTGTATATCAAAGAAGTTTAAAAACAACA
TGCTTGCTCTAAATTACTAATATGAAAATAGTTTCTGCCACTATTCAAAATAGTTGTAGATATGTAGTGT
CTACTTTGAAAAATATATTTAAAGCTTATGTAGCTGTCCTTTTGGAAAAATTAGGCAGCGGCCAGGGATC
ATGGGGTGGGTTTTGTCAGGGCCAGGGGACCTGATGCATGCAGGAAGCTGGG
Notes:The probe template was PCR amplified from IMAGE:1383201 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1383201 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14075 same embryo
 EMAGE:14078 same embryo
 EMAGE:14077 same embryo
 EMAGE:14074 same embryo
 EurExpress:euxassay_001743 same experiment
 MGI:4825566 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS