Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:141

Lefty2 left-right determination factor 2 ( MGI:2443573)
TS09 (6.5 dpc)
in situ hybridisation

Data Images
EMAGE:141
Figure 2I of Norris et al., 2002 [PMID:12091315] . Copyright: This image is from Development and is displayed with permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Only the domain denoting Lefty2 (L2) expression has been spatially annotated in this EMAGE entry. The Ebaf (lefty) probe used in this study also detects Leftb (lefty2). The two domains are marked below as L2 (Ebaf) and L1 (Leftb). Only the Ebaf (L2) domain has been spatially mapped in this EMAGE entry (see EMAGE:142 for the associated Leftb (L1) entry).
Expression Pattern Description
Spatial Annotation:
EMAGE:141Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
141_wholemount_strong_3D_1.wlz
141_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:141_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo mesoderm
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1289467
Entity Detected:Lefty2, left-right determination factor 2 ( MGI:2443573)
Sequence:sense strand is shown

>MGI:1289467
GCCTTCGACGTGACCGAGGCCGTGAACTTCTGGCAGCAGCTGAGCCGGCCGAGGCAGCCGCTGCTGCTCC
AGGTGTCGGTGCAGAGGGAGCATCTGGGGCCGGGAACCTGGAGCTCACACAAGTTGGTTCGTTTCGCGGC
GCAGGGGACGCCGGATGGCAAGGGGCAGGGCGAGCCACAGCTGGAGCTGCACACGCTGGACCTCAAGGAC
TATGGAGCTCAAGGCAATTGTGACCCCGAGGCACCAGTGACTGAAGGCACCCGATGCTGTCGCCAGGAGA
TGTACCTGGACCTGCAGGGGATGAAGTGGGCCGAGAACTGGATCCTAGAACCGCCAGGGTTCCTGACATA
TGAATGTGTGGGCAGCTGCCTGCAGCTACCGGAGTCCCTGACCAGCAGGTGGCCATTTCTGGGGCCTCGG
CAGTGTGTCGCCTCAGAGATGACCTCCCTGCCCATGATTGTCAGCGTGAAGGAGGGAGGCAGGACCAGG
nt 617 - nt 1105 of D83921.1
Notes:The probe used in this study by Norris et al., 2002 [PMID:12091315] to detect both Lefty1 (Ebaf) and Lefty2 (Leftb), is the Ebaf (lefty) probe originally described by Meno et al., 1996 [PMID:8610011] which is 97% identical to Leftb (lefty2) over the probe region and detects both Lefty1 and Lefty2. Note: The exact probe sequence lies between nt 617 and 1105 of GenBank ID D83921.1
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:ICR
Age:6.5 dpc
Theiler Stage:TS09
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Norris et al., 2002 [PMID:12091315] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:12091315] Norris DP, Brennan J, Bikoff EK, Robertson EJ 2002 The Foxh1-dependent autoregulatory enhancer controls the level of Nodal signals in the mouse embryo. Development (129):3455-68
 [ doi:10.1038/381151a0] [ PMID:8610011] Meno C, Saijoh Y, Fujii H, Ikeda M, Yokoyama T, Yokoyama M, Toyoda Y, Hamada H 1996 Left-right asymmetric expression of the TGF beta-family member lefty in mouse embryos. Nature (381):151-5
Links:MGI:2183497 same experiment
 EMAGE:142 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI