Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14509

Sncg synuclein, gamma ( MGI:1298397)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509
"Pseudo-wholemount" of euxassay_005364. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005364_01 euxassay_005364_02 euxassay_005364_03 euxassay_005364_04
EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509
euxassay_005364_05 euxassay_005364_06 euxassay_005364_07 euxassay_005364_08 euxassay_005364_09
EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509
euxassay_005364_10 euxassay_005364_11 euxassay_005364_12 euxassay_005364_13 euxassay_005364_14
EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509
euxassay_005364_15 euxassay_005364_16 euxassay_005364_17 euxassay_005364_18 euxassay_005364_19
EMAGE:14509 EMAGE:14509 EMAGE:14509 EMAGE:14509
euxassay_005364_20 euxassay_005364_21 euxassay_005364_22 euxassay_005364_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14509Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14509_wholemount_strong.wlz
14509_wholemount_moderate.wlz
14509_wholemount_weak.wlz
14509_wholemount_possible.wlz
14509_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14509_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 12 13
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 12 13 moderate expression: see section 09 10 11 not examined expression: see section 14 15
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 12 moderate expression: see section 03 13 14 15
midbrain mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 03 04 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 05 14 weak expression: see section 06
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 03 04 05 15 16
ventral grey horn
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8309
Entity Detected:Sncg, synuclein, gamma ( MGI:1298397)
Sequence:sense strand is shown

>T8309
GCAGTAGCAGCAGAGACAGCGGCTGCGGCAGCACTCCAGTCCATAGCTTGCAGCAGCCAGGTTCCATCCT
TGCAAACACCATGGACGTCTTCAAGAAAGGCTTCTCCATTGCCAAGGAAGGTGTTGTGGGTGCTGTAGAA
AAGACCAAGCAGGGAGTAACGGAGGCAGCTGAGAAGACCAAGGAGGGGGTTATGTATGTGGGCACCAAAA
CCAAGGAGAACGTGGTACAAAGTGTCACCTCAGTGGCTGAGAAGACCAAGGAGCAGGCCAATGCCGTGAG
TGAAGCTGTGGTCAGCAGCGTCAACACAGTGGCCAACAAGACCGTGGAGGAGGCTGAAAACATCGTGGTC
ACCACCGGGGTGGTGCGCAAGGAGGACTTGGAACCCCCTGCACAGGACCAAGAAGCCAAAGAGCAAGAGG
AGAATGAAGAGGCCAAGAGTGGAGAAGACTAGAAGGCTGCCAGCCAACCACAGAGGCTCAAGGGACACCC
CTCTGCCTTGGACCCTGTCTCAACCTGGCACACTGAATGCCCTGCCTAGAGTGCCCTGCAGGTTGCCCAA
GTTCTCTGTCCCTAGCCCAGTGCCACAAGTCCACACACGCTACTGCCAGCGCCAGCACCCCCTGCTGGCT
CCTTTTACCCTATGGTCCTCTGATCACCAATCAGATGCTGCTGTGATTTCTTTTTTTTTAATGATTCCAA
ATAAAACCTGAGCCCCACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1448798 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1448798 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14510 same embryo
 EurExpress:euxassay_005364 same experiment
 MGI:4828346 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS