Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14708

Fbxl22 F-box and leucine-rich repeat protein 22 ( MGI:1921415)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708
"Pseudo-wholemount" of euxassay_005656. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005656_01 euxassay_005656_02 euxassay_005656_03 euxassay_005656_04
EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708
euxassay_005656_05 euxassay_005656_06 euxassay_005656_07 euxassay_005656_08 euxassay_005656_09
EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708
euxassay_005656_10 euxassay_005656_11 euxassay_005656_12 euxassay_005656_13 euxassay_005656_14
EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708 EMAGE:14708
euxassay_005656_15 euxassay_005656_16 euxassay_005656_17 euxassay_005656_18 euxassay_005656_19
EMAGE:14708 EMAGE:14708 EMAGE:14708
euxassay_005656_20 euxassay_005656_21 euxassay_005656_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14708Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14708_wholemount_strong.wlz
14708_wholemount_moderate.wlz
14708_wholemount_weak.wlz
14708_wholemount_possible.wlz
14708_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14708_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
strong strong
regionalstrong expression: see section 03 05 16 17 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 04 05 14 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 05 06 13 14
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 15 16 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 15
spinal cord
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 06 07 11
cervical ganglion
strong strong
regionalstrong expression: see section 06 13 14
thoracic ganglion
strong strong
regionalstrong expression: see section 08 09 10 11
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 11 12 13 14 15
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3649
Entity Detected:Fbxl22, F-box and leucine-rich repeat protein 22 ( MGI:1921415)
Sequence:sense strand is shown

>T3649
TGGCCTCGAGCCAGATTCGGACGAGGGAAGCCGGAGGAGCCTCTCCAGGACTTGCTCCCAGCTCCGAGAT
GTGTTTGAGGACCCCACCCTCTGGCCCCTGCTGCACTTCCATTCTCTCGCAGAGCTCAAGAAAGACAACT
TCCGGCTGAGCCCTGCGCTGCGCAGCCTGTCCATCTGTTGGCATTCCAGCCGTGTGCAGGTGTGCAGCAT
CGAGGACTGGCTCAAGAGCGCCCTCCAGAGGAGCATCTGCAGCCAGCACGAGAGCCTGGTTAATGATTTC
CTCCTGCAGGTGTGCAACAGGTGCCCCAACCTGACGTCCGTCACGCTGTCGGGCTGCGGCCACGTCACGG
ACGACTGCCTGGCGCGCTTGCTGCTCAGCTGCCCGCGCCTGCGTACGCTGCGCCTCGAGAACTGCGCGCG
CGTTACCAACCGCACGCTGGCGGCCGTGGCCGCGCACGGGCGCGCGCTGCAGACTCTGCACGTGGACTTC
TGCCGCAACGTGAGCGCCGCCGGCCTGCTCCGCCTCCGCGCCGCCTGCCCGAACCTGCGCC
Notes:The probe template was PCR amplified from IMAGE:348445 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:348445 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14709 same embryo
 EMAGE:14710 same embryo
 EMAGE:14707 same embryo
 EurExpress:euxassay_005656 same experiment
 MGI:4824798 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS