Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14723

Arhgdig Rho GDP dissociation inhibitor (GDI) gamma ( MGI:108430)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723
"Pseudo-wholemount" of euxassay_005682. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005682_01 euxassay_005682_02 euxassay_005682_03 euxassay_005682_04
EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723
euxassay_005682_05 euxassay_005682_06 euxassay_005682_07 euxassay_005682_08 euxassay_005682_09
EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723
euxassay_005682_10 euxassay_005682_11 euxassay_005682_12 euxassay_005682_13 euxassay_005682_14
EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723
euxassay_005682_15 euxassay_005682_16 euxassay_005682_17 euxassay_005682_18 euxassay_005682_19
EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723 EMAGE:14723
euxassay_005682_20 euxassay_005682_21 euxassay_005682_22 euxassay_005682_23 euxassay_005682_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14723Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14723_wholemount_strong.wlz
14723_wholemount_moderate.wlz
14723_wholemount_weak.wlz
14723_wholemount_possible.wlz
14723_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14723_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 10 12 13 15 16
pons mantle layer
weak weak
regionalweak expression: see section 07 17
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 07 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 07 17 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04 05 not examined expression: see section 06 17 19
trigeminal v nerve
weak weak
regionalweak expression: see section 17
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 15
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 09 10 11 14 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 09 10 11 12 13 15 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6298
Entity Detected:Arhgdig, Rho GDP dissociation inhibitor (GDI) gamma ( MGI:108430)
Sequence:sense strand is shown

>T6298
CAGGAGTATGATTTGTGACTTCAGTGGAGGAAGCACCAAGAGGAGCATTGGCACGTGGCCTCTACGTGGT
CAGGTCCCTCTTCACTGATGACGACAGGCTGAACCACCTGTCCTGGGAGTGGCACCTCCATGTCTGCCAG
GACTGGAAGGACTGAACCCCACTTGGGGTCTGTATTCCCAATTTCTTGTCAGTTGCAGAGACCTGCAAGC
ATTCCCTAGACCTCCCAGTTGGTGACCAGATGTCCCCCACTCTCTGCTGTGTCCCCCCTGCCTGGTGCCT
ATTAAATGTTACCTTGTCTTCTATAGTGTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GACAAGGCCATCTTCATGGT; Reverse Primer - name:unspecified, sequence:AAGACAAGGTAACATTTAATAGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14722 same embryo
 EMAGE:14726 same embryo
 EMAGE:14725 same embryo
 EMAGE:14724 same embryo
 EurExpress:euxassay_005682 same experiment
 MGI:4823228 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS