Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14902

Avil advillin ( MGI:1333798)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902
"Pseudo-wholemount" of euxassay_007949. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007949_01 euxassay_007949_02 euxassay_007949_03 euxassay_007949_04
EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902
euxassay_007949_05 euxassay_007949_06 euxassay_007949_07 euxassay_007949_08 euxassay_007949_09
EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902
euxassay_007949_10 euxassay_007949_11 euxassay_007949_12 euxassay_007949_13 euxassay_007949_14
EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902
euxassay_007949_15 euxassay_007949_16 euxassay_007949_17 euxassay_007949_18 euxassay_007949_19
EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902 EMAGE:14902
euxassay_007949_20 euxassay_007949_21 euxassay_007949_22 euxassay_007949_23 euxassay_007949_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14902Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14902_wholemount_strong.wlz
14902_wholemount_moderate.wlz
14902_wholemount_weak.wlz
14902_wholemount_possible.wlz
14902_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14902_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rest of cerebellum mantle layer
strong strong
spottedstrong expression: see section 07 08 09 10 14 15 16 17 18
pons mantle layer
strong strong
spottedstrong expression: see section 06 07 08 18 19
midbrain mantle layer
strong strong
spottedstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 09 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35973
Entity Detected:Avil, advillin ( MGI:1333798)
Sequence:sense strand is shown

>T35973
GTGTCTCTGCTACACACCAAGCCAGAAGTGGCTGCACAGGAGAGAATGGTGGACGACGGCAAAGGCCAGG
TTGAGGTCTGGAGAATTGAGAACCTGGAGCTGGTCCCCGTGGAATACCAGTGGCATGGCTTCTTCTACGG
GGGAGACTGCTATCTGGTTCTCTACACGTACGATGTGAACGGGAAACCCCATTACATCTTGTACATCTGG
CAGGGCCGCCACGCATCCCGGGATGAGCTGGCAGCCTCAGCCTATCGGGCAGTGGAGGTGGATCAGCAGT
TTGATGGAGCCCCTGTGCAGGTCCGGGTTAGCATGGGGAAGGAGCCACGCCACTTCATGGCCATCTTCAA
AGGAAAGCTGGTTATCTACGAGGGCGGGACTTCCAGGAAGGGAAACGAGGAGCCGGACCCTCCAGTAAGG
CTCTTCCAGATCCACGGGAACGACAAATCCAACACCAAAGCAGTGGAGGTCTCGGCCTCTGCTTCCTCGC
TCAACTCCAACGACGTCTTTCTGCTGCGGACTCAGGCAGAGCACTACCTGTGGTACGGCAAGGGGTCTAG
TGGGGACGAGCGGGCGATGGCTAAGGAGCTGGTCGACCTTCTCTGTGATGGCAATGCAGACACTGTGGCT
GAGGGCCAGGAGCCACCTGAGTTCTGGGACCTTCTGGGAGGAAAAACAGCCTACGCTAATGACAAAAGGC
TGCAGCAAGAAACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74242. Forward Primer - name:074242_F_cDNA_Avil, sequence:GTGTCTCTGCTACACACCAAGC; Reverse Primer - name:074242_N_SP6_cDNA_Avil, sequence:GGTTTCTTGCTGCAGCCTTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14901 same embryo
 EMAGE:14903 same embryo
 EMAGE:14899 same embryo
 EMAGE:14898 same embryo
 EMAGE:14900 same embryo
 EurExpress:euxassay_007949 same experiment
 MGI:4823360 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS