Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14910

Thsd4 thrombospondin, type I, domain containing 4 ( MGI:2672033)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910
"Pseudo-wholemount" of euxassay_007983. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007983_01 euxassay_007983_02 euxassay_007983_03 euxassay_007983_04
EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910
euxassay_007983_05 euxassay_007983_06 euxassay_007983_07 euxassay_007983_08 euxassay_007983_09
EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910
euxassay_007983_10 euxassay_007983_11 euxassay_007983_12 euxassay_007983_13 euxassay_007983_14
EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910
euxassay_007983_15 euxassay_007983_16 euxassay_007983_17 euxassay_007983_18 euxassay_007983_19
EMAGE:14910 EMAGE:14910 EMAGE:14910 EMAGE:14910
euxassay_007983_20 euxassay_007983_21 euxassay_007983_22 euxassay_007983_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14910Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14910_wholemount_strong.wlz
14910_wholemount_moderate.wlz
14910_wholemount_weak.wlz
14910_wholemount_possible.wlz
14910_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14910_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 06 07 22
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 05 06 07 21 22
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 05 06 07 22
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 05 06 07 22
hindlimb digit 5 metatarsal
weak weak
regionalweak expression: see section 06 07 22
tongue
weak weak
regionalweak expression: see section 11 12 13 14 15 16
lower lip
weak weak
regionalweak expression: see section 07 08
upper lip
weak weak
regionalweak expression: see section 07 08
cricoid cartilage
moderate moderate
regionalmoderate expression: see section 11 12
tail skeleton
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35980
Entity Detected:Thsd4, thrombospondin, type I, domain containing 4 ( MGI:2672033)
Sequence:sense strand is shown

>T35980
GGTCTTATTTGAGCCTGTGGACTGTCTGGAGTTTCTATCTAGTGGTCTCGCATCGCTCCCCTCCACTGTG
ACTCATGACTCTTTCTTCCCACAAGCCTTGACCATCGAGACTAACTTTAATGCTGCAGGTCTGAGAGAAG
GAGCTAGGAAGCCCTCCGTAGCTCTGCTGACTCACTCTGCCCAACTGTAATTCCAAAGGCCCAGGCCTGA
AGGGACTCAGTGTTTATTGAAAGGTGAACCATCCTGGGGTGCCAGGGACTGGGGAGAGACAATTAGGAGA
AGTCTTCTTTCTTTCTTAAAAATTGTAAACTTACAGAAAGGATCTTATTTCGGGTCCTGGGCATGTTTCC
CTTAAAGAAAGCACATACTCTTAGCATACGATCTCTCCATGAAGCAGCCTGCACTATGACCGACCGCTCA
CGGCTGTGGGGATGGTATAAGCTGTCCGGTCTGCACTTCATGAGGATTCCAATGGCCTCCACCTTTTGCA
AGTGTCCCCTCAGCCTTTGTCTCTGCCTGAGAAGCGAAGCACTGCTTCCATCCGTAAGCAGCCCACCTCT
CCTGTGGAGCAGGAGACACACAGCCCAGCAGAGACCGCACTCGCCATGCTAAGCACAGAGAGAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93174. Forward Primer - name:093174_F_cDNA_B230114P05Rik, sequence:GGTCTTATTTGAGCCTGTGGAC; Reverse Primer - name:093174_N_SP6_cDNA_B230114P05Rik, sequence:CTTCTCTCTGTGCTTAGCATGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14915 same embryo
 EMAGE:14912 same embryo
 EMAGE:14911 same embryo
 EMAGE:14914 same embryo
 EMAGE:14913 same embryo
 EurExpress:euxassay_007983 same experiment
 MGI:4828705 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS