Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14919

Dpp6 dipeptidylpeptidase 6 ( MGI:94921)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919
"Pseudo-wholemount" of euxassay_008021. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008021_01 euxassay_008021_02 euxassay_008021_03 euxassay_008021_04
EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919
euxassay_008021_05 euxassay_008021_06 euxassay_008021_07 euxassay_008021_08 euxassay_008021_09
EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919
euxassay_008021_10 euxassay_008021_11 euxassay_008021_12 euxassay_008021_13 euxassay_008021_14
EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919
euxassay_008021_15 euxassay_008021_16 euxassay_008021_17 euxassay_008021_18 euxassay_008021_19
EMAGE:14919 EMAGE:14919 EMAGE:14919 EMAGE:14919
euxassay_008021_20 euxassay_008021_21 euxassay_008021_22 euxassay_008021_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14919Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14919_wholemount_strong.wlz
14919_wholemount_moderate.wlz
14919_wholemount_weak.wlz
14919_wholemount_possible.wlz
14919_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14919_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 11 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
corpus striatum
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 13 18 19 20 21
not examined not examined
single cellnot examined expression: see section 05
olfactory cortex marginal layer
moderate moderate
single cellmoderate expression: see section 09 10 11 12 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 14 15 16 17 18 19
pons mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 14 15 16 17
midbrain mantle layer
strong strong
single cellstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
trigeminal v ganglion
strong strong
single cellstrong expression: see section 03 04 05 06 18 moderate expression: see section 07 08 16 17 19 20
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36004
Entity Detected:Dpp6, dipeptidylpeptidase 6 ( MGI:94921)
Sequence:sense strand is shown

>T36004
CTCTGACCCAGACCCAATAAAGCTCTCACTACGCATACTAATTGGGGCTGCATGCCTGTGATCCAGCAAC
TCAACTTGGACCATGCTCCTTCCTAAAGAAGTTCTCAGAGGGGTCTCTTACTATTGAGGCTGGAAGTCTG
AGCTTCAAAGACTGAATTTGCATATTCACCTAGCAATCAAGGATTCTTTCAGGGTAAGAGTGGCCACAGA
AATGGGTCAAAGGTCTTGTACTGAGCCCTCCCAGCAGTTGGTACCACTAGGACTTTCAGGGAGTGATTTT
CCTGAGACTTGTTCCCAGGGACAGAAGACAACTCCCAGGTGAGTCCTCAGGCAGGCCCTTAAAGACAGCA
GTGCAGTATCTGTGGGGTTACTGGGGTCCTTTTTCAGTGTGATTCTGCAGCTCCTGGGTCTTTGCCCAAG
CCTTTTAGTCTCCTTCACTCTTGCAAAGCAGGGCAACCCATAACCCTGGAGGAAACAGGAAGTGTGCCCG
TGAAACATCTAGGGTCTCAAGTAGCAACACTTCAGTGTTTAGTAATTTTTGGTGCAAAAGATCTGCACAG
AGCAATGATGTATCCTTCCATAGGACTGGGGGGTCTCAATTGCCACATCTTACAAGACCAGGGAGGCCAT
GCTACTGTTAATTGCTGGGTTTGTGGGTTGTTTTATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75197. Forward Primer - name:075197_F_cDNA_B930011P16Rik, sequence:CTCTGACCCAGACCCAATAAAG; Reverse Primer - name:075197_N_SP6_cDNA_B930011P16Rik, sequence:CATAAAACAACCCACAAACCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14921 same embryo
 EMAGE:14916 same embryo
 EMAGE:14920 same embryo
 EMAGE:14918 same embryo
 EMAGE:14917 same embryo
 EurExpress:euxassay_008021 same experiment
 MGI:4824383 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS