Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14938

Tmem178 transmembrane protein 178 ( MGI:1915277)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938
"Pseudo-wholemount" of euxassay_007980. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007980_01 euxassay_007980_02 euxassay_007980_03 euxassay_007980_04
EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938
euxassay_007980_05 euxassay_007980_06 euxassay_007980_07 euxassay_007980_08 euxassay_007980_09
EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938
euxassay_007980_10 euxassay_007980_11 euxassay_007980_12 euxassay_007980_13 euxassay_007980_14
EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938 EMAGE:14938
euxassay_007980_15 euxassay_007980_16 euxassay_007980_17 euxassay_007980_18 euxassay_007980_19
EMAGE:14938 EMAGE:14938 EMAGE:14938
euxassay_007980_20 euxassay_007980_21 euxassay_007980_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14938Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14938_wholemount_strong.wlz
14938_wholemount_moderate.wlz
14938_wholemount_weak.wlz
14938_wholemount_possible.wlz
14938_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14938_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 10 11 12 13 14 weak expression: see section 15 16
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 06 08 09 10
midbrain mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11
ventral grey horn
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35591
Entity Detected:Tmem178, transmembrane protein 178 ( MGI:1915277)
Sequence:sense strand is shown

>T35591
ATGCACAGCAATCAAGTACCACTTTTCTCAGCCAATCCGCTTAAGAAACATTCCTTTCAATTTAACCAAG
ACAATCCAGCAAGATGAATGGCACCTGCTTCATCTAAGAAGAATAACAGCTGGCTTCCTGGGCATGGCGG
TGGCTGTCCTGCTGTGTGGCTGCATTGTGGCCACGGTCAGCTTCTTCTGGGAGGAAAGCCTGACCCAGCA
CGTGGCCGGACTCCTATTCCTCATGACAGGGATATTTTGCACCATCTCGCTCTGCACGTACGCCGCCAGT
GTCTCCTATGACTTGAACCGGGTCCCGAGCTAATTACAGCCTGCTCATGATGTGAACATGGTACAGCTGT
CCATCTTTGTGCTGTGCAGTTTAGTCTTATCGTGGCAGCTGGAGGTCTCTGCATCGCTTATCCGTGTATT
AGCCAGACGAAGATTGCACATCTAAAGTCTGGCAGGGACTCCACGGTATGACGGTCTGCACCGAAGAAGG
CCCAGCTACAGAGCAGAGCAGCAGAGTGGGTCTGAGTCCATTAGGGCAGAACTGAGTCACATCAGGGTCC
AAGCACAAAGAGGTCTTTTACATTCCAACCTGTTGCCTGCAGCCCTTTCCGGATGACTGACAGGAAACCC
TGCAGAACTTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 65085. Forward Primer - name:065085_F_cDNA_2810417M05Rik, sequence:ATGCACAGCAATCAAGTACCAC; Reverse Primer - name:065085_N_SP6_cDNA_2810417M05Rik, sequence:GAAGTTCTGCAGGGTTTCCTGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14935 same embryo
 EMAGE:14936 same embryo
 EMAGE:14939 same embryo
 EMAGE:14934 same embryo
 EMAGE:14937 same embryo
 EMAGE:14933 same embryo
 EurExpress:euxassay_007980 same experiment
 MGI:4828786 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS