Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14956

Prex1 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 ( MGI:3040696)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956
"Pseudo-wholemount" of euxassay_007998. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007998_01 euxassay_007998_02 euxassay_007998_03 euxassay_007998_04
EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956
euxassay_007998_05 euxassay_007998_06 euxassay_007998_07 euxassay_007998_08 euxassay_007998_09
EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956
euxassay_007998_10 euxassay_007998_11 euxassay_007998_12 euxassay_007998_13 euxassay_007998_14
EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956
euxassay_007998_15 euxassay_007998_16 euxassay_007998_17 euxassay_007998_18 euxassay_007998_19
EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956 EMAGE:14956
euxassay_007998_20 euxassay_007998_21 euxassay_007998_22 euxassay_007998_23 euxassay_007998_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14956Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14956_wholemount_strong.wlz
14956_wholemount_moderate.wlz
14956_wholemount_weak.wlz
14956_wholemount_possible.wlz
14956_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14956_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 18 19 20 21 22 23 weak expression: see section 17
humerus
weak weak
regionalweak expression: see section 01 02 23 24
femur
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 03 21 22
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 06 07 08 09 17 18 19 20 21 22 23 24 weak expression: see section 02 05 12 14
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 15 16 17 18 19 20 weak expression: see section 10 11
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 10 11 16
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 10 11 12 13 14 15
rest of cerebellum ventricular layer
weak weak
regionalweak expression: see section 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 15 16 17 18 19 20 21 22 moderate expression: see section 03 11 14
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 15 16 17 18 19 20 21 22 moderate expression: see section 11 14
palatal shelf
strong strong
regionalstrong expression: see section 08 17 18 not examined expression: see section 19
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 04 21 22 23 24 moderate expression: see section 01
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36041
Entity Detected:Prex1, phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 ( MGI:3040696)
Sequence:sense strand is shown

>T36041
GAAGATTGACCAGCTGATTCGTCCCATCAATGCCCTGGATGAGCTCTACCGCCTCATGAAGACCTTCGTG
CACCCCAAAGCGGGTGCTGCTGGGAGCCTGGGTGCTGGTCTCATCCCCGTCTCCTCCGAGCTCTGCTATC
GCCTGGGGGCGTGTCAGATCACCATGTGTGGCACCGGCATGCAGCGGAGCACCCTGAGCGTGTCCTTGGA
ACAAGCAGCCATCTTGGCACGGAGTCACGGCCTGTTGCCCAAGTGTGTCATGCAGGCCACAGACATCATG
CGCAAGCAGGGCCCCCGAGTGGAGATTCTGGCCAAAAACCTCCGCATCAAGGACCCCATGCCCCAAGGTG
CACCACGCCTCTACCAGCTCTGCCAGCCTCCGGTGGATGGAGACCTCTGAACACCAACATGTTCCCTGCT
TGGTCACTGCCTCAAGCAGCTGCGGTGTGAGAGGACACGGAGGGTCTGCAAGGGCACCCGAGGCTTCTGC
CATTGCTGTGTCAAGACCTACCCAGATGACCCCGCTGCCACTGTCTGGGACAAGCCTCTGCGCACATCCT
CTCTCTGGACTGGCTGATCACTGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79913. Forward Primer - name:079913_F_cDNA_BC067047, sequence:GAAGATTGACCAGCTGATTCGT; Reverse Primer - name:079913_N_SP6_cDNA_BC067047, sequence:AGCAGTGATCAGCCAGTCCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14960 same embryo
 EMAGE:14957 same embryo
 EMAGE:14961 same embryo
 EMAGE:14959 same embryo
 EMAGE:14958 same embryo
 EurExpress:euxassay_007998 same experiment
 MGI:4827407 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS