Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15012

Epha3 Eph receptor A3 ( MGI:99612)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012
"Pseudo-wholemount" of euxassay_008049. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008049_01 euxassay_008049_02 euxassay_008049_03 euxassay_008049_04
EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012
euxassay_008049_05 euxassay_008049_06 euxassay_008049_07 euxassay_008049_08 euxassay_008049_09
EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012
euxassay_008049_10 euxassay_008049_11 euxassay_008049_12 euxassay_008049_13 euxassay_008049_14
EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012 EMAGE:15012
euxassay_008049_15 euxassay_008049_16 euxassay_008049_17 euxassay_008049_18 euxassay_008049_19
EMAGE:15012 EMAGE:15012
euxassay_008049_20 euxassay_008049_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15012Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15012_wholemount_strong.wlz
15012_wholemount_moderate.wlz
15012_wholemount_weak.wlz
15012_wholemount_possible.wlz
15012_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15012_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
tarsus
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 09
head mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 07 08 09 20 21
anterior abdominal wall muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 18
axial muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 13 14
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 14 16 17 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19
vomeronasal organ
strong strong
regionalstrong expression: see section 12 13 16
tongue
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 15 16
lower lip
strong strong
regionalstrong expression: see section 10 17 18 19
lower jaw incisor
strong strong
regionalstrong expression: see section 14 moderate expression: see section 12 13
upper lip
strong strong
regionalstrong expression: see section 09 10 11 15 16 17 18 19
upper jaw incisor
strong strong
regionalstrong expression: see section 14 moderate expression: see section 11 12 13
clavicle
moderate moderate
regionalmoderate expression: see section 07 12 13
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36345
Entity Detected:Epha3, Eph receptor A3 ( MGI:99612)
Sequence:sense strand is shown

>T36345
GAGTTACGGGATTGTTCTCTGGGAAGTGATGTCTTACGGAGAAAGGCCATACTGGGAGATGTCCAATCAG
GATGTAATTAAGGCTGTGGATGAGGGCTATCGCCTGCCACCTCCCATGGATTGCCCAGCTGCCTTGTATC
AGTTGATGTTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTCGAGCAGATCGTCAGCATTCT
GGACAAACTCATCCGGAATCCAGGCAGTCTGAAGATCATCACCAGCGCGGCTGCAAGGCCATCAAACCTT
CTTCTGGACCAAAGCAATGTCGATATCGCTACCTTCCACACAACTGGTGATTGGCTTAACGGCATGAGGA
CAGCACACTGTAAGGAAATCTTCACAGGCGTCGAATACAGCTCCTGTGACACCATTGCCAAGATCTCCAC
AGATGACATGAAAAAGGTTGGTGTCACTGTGGTTGGGCCACAGAAGAAGATCATCAGCACCATTAAAGCT
CTAGAAACACAATCTAAGAATGGTCCAGTTCCAGTGTAAAGTCCTGGAGGGATGTGAGAAACGGGAAGAT
GCAGCAGCATCCTGCAGACAGATGGAAATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 89951. Forward Primer - name:089951_F_cDNA_Epha3, sequence:GAGTTACGGGATTGTTCTCTGG; Reverse Primer - name:089951_N_SP6_cDNA_Epha3, sequence:CATTTCCATCTGTCTGCAGGAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15011 same embryo
 EMAGE:15008 same embryo
 EMAGE:15010 same embryo
 EMAGE:15009 same embryo
 EurExpress:euxassay_008049 same experiment
 MGI:4824580 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS