Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15014

Erbb4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) ( MGI:104771)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014
"Pseudo-wholemount" of euxassay_008088. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008088_01 euxassay_008088_02 euxassay_008088_03 euxassay_008088_04
EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014
euxassay_008088_05 euxassay_008088_06 euxassay_008088_07 euxassay_008088_08 euxassay_008088_09
EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014
euxassay_008088_10 euxassay_008088_11 euxassay_008088_12 euxassay_008088_13 euxassay_008088_14
EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014 EMAGE:15014
euxassay_008088_15 euxassay_008088_16 euxassay_008088_17 euxassay_008088_18 euxassay_008088_19
EMAGE:15014 EMAGE:15014 EMAGE:15014
euxassay_008088_20 euxassay_008088_21 euxassay_008088_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15014Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15014_wholemount_strong.wlz
15014_wholemount_moderate.wlz
15014_wholemount_weak.wlz
15014_wholemount_possible.wlz
15014_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15014_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20 21
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 16
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36351
Entity Detected:Erbb4, v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) ( MGI:104771)
Sequence:sense strand is shown

>T36351
GGTAGAGCCCTTAACTCCCAGTGGCACGGCACCCAATCAAGCTCAACTTCGCATTTTGAAGGAAACCGAA
CTAAAGAGGGTAAAGGTCCTTGGCTCGGGAGCTTTTGGAACCGTTTATAAAGGTATTTGGGTGCCTGAAG
GTGAAACAGTGAAAATCCCTGTGGCTATAAAGATCCTCAATGAAACAACTGGCCCCAAAGCCAACGTGGA
GTTCATGGATGAGGCTCTGATCATGGCAAGTATGGATCACCCACACCTAGTTCGCCTATTGGGAGTGTGT
CTGAGTCCCACTATCCAGTTGGTTACGCAGCTGATGCCGCATGGCTGCCTACTGGACTATGTTCATGAAC
ACAAGGATAACATTGGATCACAGCTGCTGTTGAACTGGTGTGTCCAGATTGCTAAGGGAATGATGTACCT
AGAAGAAAGACGGCTTGTTCATCGGGATCTGGCAGCCCGCAATGTCTTAGTGAAATCTCCAAATCATGTT
AAAATCACAGATTTTGGACTGGCCCGGCTCTTGGAAGGAGATGAAAAAGAATACAATGCTGATGGTGGCA
AGATGCCAATTAAATGGATGGCTCTGGAATGTATACATTATAGGAAATTCACACATCAAAGTGATGTTTG
GAGCTATGGCGTCACTATATGGGAACTGATGACCTTTGGAGGAAAGCCCTATGATGGAATTCCAACCCGA
GAAATCCCCGATTTACTGGAGAAAGGAGAGCGTCTGCCTCAGCCTCCCATCTGCACTATTGATGTTTACA
TGGTCATGGTCAAATGTTGGATGATCGATGCTGACAGCAGACCTAAATTCAAAGAACTGGCTGCTGAGTT
TTCAAGAATGGCTAGAGACCCTCAAAGATACCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 75687. Forward Primer - name:075687_F_cDNA_Erbb4, sequence:GGTAGAGCCCTTAACTCCCAGT; Reverse Primer - name:075687_N_SP6_cDNA_Erbb4, sequence:AGGTATCTTTGAGGGTCTCTAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15018 same embryo
 EMAGE:15013 same embryo
 EMAGE:15017 same embryo
 EMAGE:15015 same embryo
 EMAGE:15016 same embryo
 EurExpress:euxassay_008088 same experiment
 MGI:4824609 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS