Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15015

Etnk1 ethanolamine kinase 1 ( MGI:1922570)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015
"Pseudo-wholemount" of euxassay_008092. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008092_01 euxassay_008092_02 euxassay_008092_03 euxassay_008092_04
EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015
euxassay_008092_05 euxassay_008092_06 euxassay_008092_07 euxassay_008092_08 euxassay_008092_09
EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015
euxassay_008092_10 euxassay_008092_11 euxassay_008092_12 euxassay_008092_13 euxassay_008092_14
EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015 EMAGE:15015
euxassay_008092_15 euxassay_008092_16 euxassay_008092_17 euxassay_008092_18 euxassay_008092_19
EMAGE:15015 EMAGE:15015 EMAGE:15015
euxassay_008092_20 euxassay_008092_21 euxassay_008092_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15015Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15015_wholemount_strong.wlz
15015_wholemount_moderate.wlz
15015_wholemount_weak.wlz
15015_wholemount_possible.wlz
15015_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15015_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 07 14 15
thymus primordium
weak weak
regionalweak expression: see section 08 09 11 12
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 15 16
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 12 13 14 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16 weak expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36355
Entity Detected:Etnk1, ethanolamine kinase 1 ( MGI:1922570)
Sequence:sense strand is shown

>T36355
CAAGCTCGTTACAACGTTCAAGCAAACCTGAAAAAAGAAAAAACAACTGGCTTAGTGGAATTTTCATTCA
TGGTTGAAACATTGTCGTAGGATGATAAAAATGTGAGCCTCCTGATTCTTTTCTTTCCTCCTTAAAATCC
GAGAGTGTGTGTCATGTGGAAACCCTGGAGAAGACAGTGTTGCTAGTCTGTTCCTGTTCGTGAGAATGCT
TTGAATGGAGGCTCACTGTGCTGCGGCGGCTGCGGCTGCTGCCGGTGCTGCTGGACTGCAAAGCAGCCAG
CGGAAATGTGACAGGCTCCTGTGGCGTGAGTGCAATGACAGCGAGGCGTCCTTGTTCACCCTGCTAGCAC
GTAAGAGATCGTGGAGAGAGACCAGCACACGGGAACTCTTGCCCCCATTCCTTGGCCAGATTTGGGTGCT
CTGATGCACCCGCTTCTCATACAGCTTTTGGGGATCATGGTGTAGACTATCAAGAGGATTCAAAATGTCT
TTCTTTGTATTGACCATGTAAGGGATTCTAAAGAGGGTATATTGGGACTGTTCTGAAGAGCATCCCTCTA
AAATGTGTCCTGTGGCTTGCTAGATATCAGTTGCCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 80038. Forward Primer - name:080038_F_cDNA_Etnk1, sequence:CAAGCTCGTTACAACGTTCAAG; Reverse Primer - name:080038_N_SP6_cDNA_Etnk1, sequence:AAGGCAACTGATATCTAGCAAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15014 same embryo
 EMAGE:15018 same embryo
 EMAGE:15013 same embryo
 EMAGE:15017 same embryo
 EMAGE:15016 same embryo
 EurExpress:euxassay_008092 same experiment
 MGI:4824632 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS