EMAGE mouse gene expression spatial database

EMAGE:15026

Fanca Fanconi anemia, complementation group A ( MGI:1341823)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_008108. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_008108_01	euxassay_008108_02	euxassay_008108_03	euxassay_008108_04

euxassay_008108_05	euxassay_008108_06	euxassay_008108_07	euxassay_008108_08	euxassay_008108_09

euxassay_008108_10	euxassay_008108_11	euxassay_008108_12	euxassay_008108_13	euxassay_008108_14

euxassay_008108_15	euxassay_008108_16	euxassay_008108_17	euxassay_008108_18	euxassay_008108_19

euxassay_008108_20

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T36364
Entity Detected:	Fanca, Fanconi anemia, complementation group A ( MGI:1341823)
Sequence:	sense strand is shown >T36364 CTACAGGAGATCGCTCTGGACTTGGAGCTGGATCAAGGTTCTGCTGTGCCCCATGGCTGTTCTACGCCGC AGAGTCACTTTCTGTTTCGGGTGTTCAGAAGACGGCTGCAGGCTCTGGCAAGGCCAGACAGCATGGCTAC CAGCCTCAGGAGACAACAAGAACTGCTCACATGCAAACGGCTTCTCCTCTGCCTGCCTCCATCTGTTCTC GTGGGTGGCCCCCAGGCCGGACAACCTATCTCCCCCAACTGTGGAGAGTTCTTTAGCCTGGTCAACTCTG AGTTGAGAAACTTCTGTTGCCACGGCAGTGTCCTGACCTCTGACATTACCATCCACTTCTTCAGGGGGCT CCTTCGTGTGTGTCTCCGAAGTCAAGACCCAGCATTGGTGGCCAACCAGACACTGACAGAATGCCAGACT AAGTGTCCCGTGATTCTGACTTCAGCACTGTTGTGGTGGTCGAGCCTGGAGCCAGTGCTGTGTGGTCGGT GGATGAGATGTTATCAGAGCCCACTGCCTC
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74822. Forward Primer - name:074822_F_cDNA_Fanca, sequence:CTACAGGAGATCGCTCTGGACT; Reverse Primer - name:074822_N_SP6_cDNA_Fanca, sequence:GAGGCAGTGGGCTCTGATAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:15025 same embryo
	EurExpress:euxassay_008108 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source