Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15138

Fstl4 follistatin-like 4 ( MGI:2443199)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138
"Pseudo-wholemount" of euxassay_010347. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010347_01 euxassay_010347_02 euxassay_010347_03 euxassay_010347_04
EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138
euxassay_010347_05 euxassay_010347_06 euxassay_010347_07 euxassay_010347_08 euxassay_010347_09
EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138
euxassay_010347_10 euxassay_010347_11 euxassay_010347_12 euxassay_010347_13 euxassay_010347_14
EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138
euxassay_010347_15 euxassay_010347_16 euxassay_010347_17 euxassay_010347_18 euxassay_010347_19
EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138 EMAGE:15138
euxassay_010347_20 euxassay_010347_21 euxassay_010347_22 euxassay_010347_23 euxassay_010347_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15138Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15138_wholemount_strong.wlz
15138_wholemount_moderate.wlz
15138_wholemount_weak.wlz
15138_wholemount_possible.wlz
15138_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15138_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 22 23 24
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 11 12 13 14 16 17 18 19
medulla oblongata basal plate mantle layer
weak weak
spottedweak expression: see section 08 09 10 11
pons mantle layer
weak weak
regionalweak expression: see section 03 07 13
neural retina
strong strong
regionalstrong expression: see section 01 02 03 24 moderate expression: see section 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37577
Entity Detected:Fstl4, follistatin-like 4 ( MGI:2443199)
Sequence:sense strand is shown

>T37577
CTACAGGTGATCACAGAAGCCAGCACTGGCCAAGGCCAGCACCTCATCCGAACACCGTTTGCAGGAGTGG
ACAATTTCTTTATACCGCCAACAAATCTCATCATCAACCATATCAGGTTTGGCTTCATCTTCAACAAGAC
TGACCCTGCTGTCCACAAAGTTGACCTGGAGACTCTGATGGCACTGAAGACAATCAGCCTACGTCACTAC
GGCTGCATGCCTCAGGCCATGGCACACACCCACCTTGGTGGCTACTTCTTCGTGCAGTGTCAACAGGACA
CACCTACCTCCACCGGCCCACAGCTGCTCATTGACAGTGTCACAGACTCGGTGCTAGGCCCCAACAGTGA
TATCACAGGCACGCCCCACGTGTCCCCTGACGGACGCTTCATCGTCAGTGTCTCCAACAAGGGCCCCTGG
CTGCACGTGCAGGAGGTCACAGTGCGGGGGGAAATCCAGACGCTATACGACCTAAAAATAAACCCAGGCA
TCTCCGACTTGGCATTCCAGCATTCCTTCACAGAAGGTAGTCAGTACAACGCCTATGCCACTCTCGACAA
GGAGCCAGACCTGCTCTTCCTGGAGCTGTCCACTGGGAAGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 102064. Forward Primer - name:102064_F_cDNA_B230374F23Rik, sequence:CTACAGGTGATCACAGAAGCCA; Reverse Primer - name:102064_N_SP6_cDNA_B230374F23Rik, sequence:CATCTTCCCAGTGGACAGCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15137 same embryo
 EMAGE:15140 same embryo
 EMAGE:15142 same embryo
 EMAGE:15141 same embryo
 EMAGE:15139 same embryo
 EurExpress:euxassay_010347 same experiment
 MGI:4824940 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS