Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15164

Hopx HOP homeobox ( MGI:1916782)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164
"Pseudo-wholemount" of euxassay_010529. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010529_01 euxassay_010529_02 euxassay_010529_03 euxassay_010529_04
EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164
euxassay_010529_05 euxassay_010529_06 euxassay_010529_07 euxassay_010529_08 euxassay_010529_09
EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164
euxassay_010529_10 euxassay_010529_11 euxassay_010529_12 euxassay_010529_13 euxassay_010529_14
EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164
euxassay_010529_15 euxassay_010529_16 euxassay_010529_17 euxassay_010529_18 euxassay_010529_19
EMAGE:15164 EMAGE:15164 EMAGE:15164 EMAGE:15164
euxassay_010529_20 euxassay_010529_21 euxassay_010529_22 euxassay_010529_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15164Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15164_wholemount_strong.wlz
15164_wholemount_moderate.wlz
15164_wholemount_weak.wlz
15164_wholemount_possible.wlz
15164_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15164_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 20 21
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 16 17 18 weak expression: see section 19 20
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 11 14 15 moderate expression: see section 12
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 16 moderate expression: see section 12
pons mantle layer
strong strong
regionalstrong expression: see section 06
pons ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 16 17 18 19 moderate expression: see section 11
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15
spinal cord lateral wall
strong strong
regionalstrong expression: see section 10 11 12
anterior naris
strong strong
regionalstrong expression: see section 11 moderate expression: see section 12 15
external naris
strong strong
regionalstrong expression: see section 16
heart atrium
moderate moderate
regionalmoderate expression: see section 05 06 08 09 14 15 16 17 18 19 20
heart ventricle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30272
Entity Detected:Hopx, HOP homeobox ( MGI:1916782)
Sequence:sense strand is shown

>T30272
ATCTCCGGAGGCAGCACTTGAGGCGCTTCCTCAGTATACTGTCCCCTCGGAGTGTCAGGCGGGAGGCGTC
TTCTTCCTCCTCTCCATCCTTAGTCAGACGCGCACGGACCATGTCGGCGCAGACCGCGAGCGGCCCCACG
GAGGACCAGGTGGAGATCCTGGAGTACAACTTCAACAAGGTCAACAAGCACCCGGACCCCACCACGCTGT
GCCTCATCGCAGCCGAGGCGGGTCTCACGGAGGAGCAGACGCAGAAATGGTTTAAGCAGCGCCTGGCAGA
GTGGCGGCGGTCAGAAGGCTTGCCTTCGGAATGCAGATCTGTTACGGACTAGGGAGCCAGGCCCTTGAGC
TTGCTCTTGGAACTCCATCTCTTCTTCCTTCCCTCGGCTTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4989797), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 33989. Forward Primer - name:033989_F_IRAV71-74_F09_Hod, sequence:ATCTCCGGAGGCAGCACT; Reverse Primer - name:033989_R_SP6_IRAV71-74_F09_Hod, sequence:GGTAAGCCGAGGGAAGGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15163 same embryo
 EMAGE:15162 same embryo
 EMAGE:15166 same embryo
 EMAGE:15167 same embryo
 EMAGE:15165 same embryo
 EurExpress:euxassay_010529 same experiment
 MGI:4825409 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS