Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15229

Dpysl3 dihydropyrimidinase-like 3 ( MGI:1349762)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229
"Pseudo-wholemount" of euxassay_010399. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010399_01 euxassay_010399_02 euxassay_010399_03 euxassay_010399_04
EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229
euxassay_010399_05 euxassay_010399_06 euxassay_010399_07 euxassay_010399_08 euxassay_010399_09
EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229
euxassay_010399_10 euxassay_010399_11 euxassay_010399_12 euxassay_010399_13 euxassay_010399_14
EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229 EMAGE:15229
euxassay_010399_15 euxassay_010399_16 euxassay_010399_17 euxassay_010399_18 euxassay_010399_19
EMAGE:15229 EMAGE:15229 EMAGE:15229
euxassay_010399_20 euxassay_010399_21 euxassay_010399_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15229Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15229_wholemount_strong.wlz
15229_wholemount_moderate.wlz
15229_wholemount_weak.wlz
15229_wholemount_possible.wlz
15229_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15229_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 16 17
telencephalon
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hindbrain
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
strong strong
homogeneousstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 05 06 07 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 17 18 19 20 21
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 17
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 17
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 10 15 16
cervical ganglion
strong strong
regionalstrong expression: see section 09 16
thoracic ganglion
strong strong
regionalstrong expression: see section 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 15 16 17
neural retina
strong strong
regionalstrong expression: see section 02 03 04 05 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 11 12 13 16 17 moderate expression: see section 14 15 18
vomeronasal organ
strong strong
regionalstrong expression: see section 13 16
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12
midgut
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 22 weak expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30241
Entity Detected:Dpysl3, dihydropyrimidinase-like 3 ( MGI:1349762)
Sequence:sense strand is shown

>T30241
GCGACCTTGTCATCTGGGATCCAGATGCCTTGAAGATTGTCTCTGCCAAGAACCACCAGTCGGTTGCCGA
ATACAACATCTTTGAAGGGATGGAGCTGCGTGGTGCACCTCTGGTGGTTATCTGCCAGGGCAAGATCATG
CTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATTCCCTGCAGCCCATTCTCTGACT
ATGTCTATAAGCGCATTAAAGCAAGGAGGAAGATGGCAGACCTGCATGCAGTCCCAAGAGGCATGTATGA
TGGACCAGTGTTTGACTTGACCACCACCCCCAAGGGGGGCACCCCAGCTGGCTCTACTCGGGGCTCTCCC
ACTCGGCCAAACCCGCCAGTGAGGAACCTCCATCAGTCAGGATTTAGCCTGTCAGGCACCCAAGTGGATG
AGGGTGTCCGCTCAGCTAGCAAACGCATTGTGGCACCCCCTGGAGGCCGTTCTAACATCACATCCCTGAG
TTAAGCCCTCCCAAAGAGGGAGGCAGAAGCAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5367381), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 9705. Forward Primer - name:ABA_MGC_006_02_F02_F_AGGTGAAGGGGCCAAGTC_ABA_REV_00, sequence:GCGACCTTGTCATCTGGG; Reverse Primer - name:_R_SP6_ABA_MGC_011_02_B06_GCGACCTTGTCATCTGGGATCCAG, sequence:TTTGCTTCTGCCTCCCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15230 same embryo
 EMAGE:15225 same embryo
 EMAGE:15228 same embryo
 EMAGE:15227 same embryo
 EMAGE:15226 same embryo
 EurExpress:euxassay_010399 same experiment
 MGI:4824391 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS